Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9597  (registered. 2012)
Contig Information
Length 1893 bp
Clones alternative view 85 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 5
Wh_r Root 4
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XA Root 3
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499718|ref|NP_001146018.1|| hypothetical protein LOC100279549 [Zea mays]
Score 925
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9597
TTTTTTTTTTGGCGAAAAAACACATTGATTCTGTAATGATTTCAGCAAAACAGGCTACAAAGTTCGTTCATGGGATACAACGGAAAACCTCCTCAGGCAG
CACAGGGGCCCGAGGATTTGATTATAAGTAAGATCTACAGACGCAAACATGTATCGAATCGAAACTTGACAAGACATGAAGATTTGCTAAAATTTTATGG
CCGACAGAGAAAATGTAGATGCTTCTCCTGCAAAATGCAAACTATAAATAATGAATGATGGTCAAACCACTTCTTGCTCTTCCTCCGATCCGGCGGGGCG
ACGAGGTGAACTTAGGCCACGGCGGGCATGTCCTTGAGCCAGCCGTCGAGCGGCTTGCCGATGGAGTAGACGATGAAGCCCATCTCCCTGAGCTTCTCGG
CGTCGACCACGTTGCGGCCGTCGAAGACGAAGGCCGGCTTCTGCATGTTGTCGAAGATCTTCTGGTAGTCGAGCTTCTTGAACTCGTCCCACTCGGTGAG
GATGCACACGCCGTGGGCGCCCTTGCAGGCCTCGTACGCGTCCCACACCACGCTCACCTGCTTCACCGCCGTGGGGCTGGTCGGCTGCAGGTGCATCGGG
TGGTCCCAGTCGAACTTGTTCATGGCCAGGTCCCGCTGGATCTGCTCCTCCGTCACCTGCGGGTCGTAGATGCTCACCTGGGCCTTGTCGCCCACCAGGC
CCTTGCACACGTCGATCGCCGGCGTCTCCCGGGTGTCGCCCGTGTCCTTCTTGAACGCGAACCCGAGCACCGCGATCTTCTTGCCGGACACCGTGTTGAA
CATGGACGACACCACCCGGTTCACGAACCGGCTCTTCTGGTAGTCGTTGATCTTGATCACCTGCTTCCAGTAGTTGGCCACCTCCGGCAGGCCGTTGCAC
TCGCAGATGTACACCAGGTTCAGGATGTCCTTCTGGAAGCACGACCCGCCGAACCCCACGCTGGCGTTCAGGAACTTGGGCCCGATCCGCGAGTCCTTGC
CGATGGCGTACGACACCTCCGACACGTTGGCGCCGGTGGCCTCGCACAGCGCCGACATGGCGTTCACGGACGAGATCCTCTGCGCCAGGAACGCGTTGGC
GGCCAGCTTGGAGAGCTCGGCCGACCACAGGTTGGTGGTGATGATGTTCGCCTCGGGCACCCAGTGGGCGTACACCTCCTTGAGGGCCTGGACGGCCTTC
TGGCCCCCGGGGGTCTCCCGGCCGCCGATGAGCACCCTGTCGGGCTTGAACAGGTCCTCGATCGCCGTGCCCTCGGCGAGGAACTCCGGGTTGGACAGGA
TCTGGTAGTTGATGCCCTTGCTGTTGTGGGTCAGGATCTTCTCGATGGCCTCGGCGGTCTTGACAGGCACGGTGGACTTCTCGACGACGATCTTGTCCGA
CTTGGACACGTCGGCGATCATCCGGGCGGCGCTCTCCCAGTAGGTGAGGTCGGCGGCCTTGCCGGCTCCCAGGCCGCGGGTCTTGGTGGGGGTGTTCACG
GACACAAAGATGATGTCGGCCTCGGCGACATGCTTCTCAACATCAGTGCTGAAGAAGAGGTTCTTGCCCCTGCAGGCCTTGACAACGTCGTCGAGGCCGG
GCTCGTAGATGGGGAGGGTGTCGCTGTTCCAGGCGTCAATGCGGGGCTTGGAGATGTCGACGACAACAACCTCGATCGCCGGGCACTTGATGGCAATGAC
GGCCATGGTTGGGCCGCCGACGTAGCCAGCTCCGATGCAGCAGATCTTCACCATCTTGGCTGCTTACAACCAGATCTCAGGAACTCGGGGAAGATCTCGA
GAGGAGGGGCGCGCACTGCTGGAGGAAGGAAAGCAAGGGAGGCGACTTCTTGGTGTATGCAGAGAAGCCTCGTGCCGAATTCCTGCAGCCCGG
page-top