Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig779  (registered. 2007)
Contig Information
Length 648 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0525C06.2 [Oryza sativa (indica cultivar-group)]
Score 281
Evalue 1.71235e-23
Total Hit Count 419
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig779
GTTATAGCACAACCAATGCTACCCCCACCAATGAGGGATGTTCCCATGCAAATGCCATATCCTGAGATGGTTTACATGCCACCACCACCACCACCACTGG
GAGTACCTATGATGGCTCCTCCTCTCTCGCCTCCTAGAGGTTTTGCTGATAACAAGAGCACAGTGGAAGTTTGCAGGGACTACTTGAAGAAAATGTGCAA
TAGAGAATCATGTAGATTTGCACACCCTGATTCACAAACTGAGGTGGCACATGACAAGGTTGAAGTTTGCCGTGATTTTAAACGAGGAGAATGCACTCGA
CCTACATGCCGCTTTTACCACCCATCCTCAAGCTGAAGTTCTGTTAGATAAATCTTTCATGCCCCGCTCTGCTGCTGCTGCCGCCGCCGCTGCTGCTAAT
CCTGCTACCGCTGCGAAAGAGCTGCTGCGCTGGCTGTTATGATGCTAAGGTGCCATAGAGTATGAGACCGTCGCAAGTGCTATGTCTCTGGAAGGAAAAC
AAAACTTGTTACTATCGTGTGATGTTCAGATGGTTTGCTTGAACTTGACTCAGCTCCGAAGTAGTCTTCTTCACAATGGACTTTGCATGTGCGGTTGGTG
TATTTGCGTTCATAAAGATGTTTTAGACTTTTCGCTGCAAAAAAAAAA
page-top