Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig959  (registered. 2012)
Contig Information
Length 753 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_CA 1
WH_XA Root 3
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|166197629|dbj|BAG06230.1|| plasma membrane intrinsic protein [Hordeum vulgare]
Score 282
Evalue 3.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig959
TTTTTTTTTTCAATCAAACACGCATGCATCACACAATAAATTAATCCATGTTCCAAATTGCAGCAGTTGTCACTCACAGCGGTTTTACATTACAGGTTCA
TCATCCATCAACACCAACACTAACGGTAACTAATATAATTCGACAACATTAACGGTGACAGGGAGTAATAATTGAAGGGTGAAAACGCGCCACGAATCAC
GCATGCTGGCCTTCCTCTCACTCACATGCATGCACAGACACTGAACGACGAGGCCGGATGGACACGCTAGCTTGTGTGGCTGGCTAGCGCGGTGGGTGAC
CGTTGCATTAAATTATTGGCCGGCCGGCTCAGTTGCTCCGGCTGCTCCGGAAGGAGCCGAGCGCCTTGATGGCCGCCGCCCGGAGGATGTACTGGTGGTA
CGCCGCCGCCGCCAGCGCTCCCACGAACGGGCCGACCCAGAAGATCCAGTGGTTGTCCCATGCGGCCTTCTTGTTGTAGATGACGGCGGCGCCGAGGCTC
CTGGCGGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCGAGGTGCACCATGAAGACCGCGAACCCGATGGGGAGCGGCGCCAGCACGGGGACGTGCG
AGTCGCGGGCGCTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTAGACGAGCACGAAGGTGCCGACGATCTCCGCCCCCAGCGCGGTGCCGCGGGAGAA
GCCGGAGGCCACCATGTTGGCGCCGCCGCCGTTGGCCTGGTACGCGTCCTTCA
page-top