Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9564  (registered. 2012)
Contig Information
Length 708 bp
Clones alternative view 70 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 6
Wh_oh Pistil at heading date 4
Wh_r Root 3
Wh_yd Spikelet at late flowering 4
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 8
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471698|gb|AAW50980.1|| ribosomal protein L36 [Triticum aestivum]
Score 212
Evalue 3.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9564
GCACGAGGCCTCGTGCCGAATTCGGCACGAGGCTTCTCCCAGGTAAAGGAAAGATTCGCCCATGGCTCCGTCGCAGCCCAAGTCGGGCCTCTTCGTCGGC
ATCAACAAGGGCCACGTCGTCACCAAGCGCGAGCTGCCGCCGCGCCCGTCCGACCGCAAGGGGAAAGGTACCAAGAGGGTGCATTTCGTCAGGAACTTGA
TCAGGGAGGTCGCTGGGTTTGCTCCGTATGAGAAGCGTATCACTGAGCTTCTCAAGGTTGGCAAGGACAAGCGTGCCCTGAAGGTGGCGAAGCGAAAGTT
GGGTACCCACAAGAGGGCGAAGAAGAAGAGAGAGGAGATGTCCAGTGTCCTCAGGAAGATGAGATCTGCTGGAACTGGAACAGACAAGAAGAAATAGAGC
ATCCCAGGCTCATTAAGTTGATGGCAATCTTCTGTTCTGGTGTCCAGTTTTTACTGCATGTAGAACCTACTAGACCTGAAACTGTTATCCGCTAGCTAAA
CATTATGCTATGTTGAACCTCCTGTCTTGTGAGATTTTTGATCTAACTTGCAATGCATCGTTTGCCACCCTAAAAAAAAAATCGCTTCTATGATCCGTCT
TGATTCCATCTGCCATTCTTGTGCCAGATGCTTTACAATTGATGTATGTGTGCTTAATTTCTGTGATCTAACTTATCAAAACATGCTCCTTGAATATGAA
TTAACTTA
page-top