Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig435  (registered. 2007)
Contig Information
Length 667 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06088 [Oryza sativa Indica Group] (no hit)
Score 591
Evalue 1.71399e-59
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig435
CCCCTTTCCTCGATCTCTCTCTTCTCCTCGCGTGAAACCGATGCTGCCGTCGCCATGGCCGCGACCACCGTGCTCCCCGCGCCGCGAGAAGACGCCCAGA
AGGACTGCCATGGTCCACTTCGTCCATCACGAGGACCGAATCGAGCGGGGAAGGCCCGTACACTCGCCATCGCCACCATCTTCATCTTGTACATCGCCGC
GGCCTCGACGTCGATCCGCATCACCTCGTCCATCCCGGCCTCGTACGAGCTCACCACCGACCTCCTCTCGACCCCGTGACGATGCTGATGCCCCTGTGAT
CGACTACGTCACCGACGACCCCTCCTTCTCGCCTGAGCAACCAGGCAAGCCCCCCCTTTGATCATCCCGATGACGGAGTCCAGGAGCCAGATGACACCTT
TGACGACTGCTACTACACCAAGGGCGTCTGCTACCACGTGACGGAGACCGCCGATGACCAGGTGTAGTTAGGAGGCTCCCAGGCAGGAGGCCTTGCCTTT
TCGATCATAGATGCTTTTGTGCTAGCCTTCTTAAGGCAAACTTGTTTAACTTATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTCGTTTGTATTCAA
GCTGATGTATTCGAGCCCTCGAGGCCCCTGGCTTGTAATATAAAGCTTGTATTATTTAAAAAAAAAA
page-top