Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9551  (registered. 2012)
Contig Information
Length 1311 bp
Clones alternative view 62 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 9
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_CA 3
WH_SP 5
WH_XA Root 6
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439261|ref|NP_001043910.1|| Os01g0686800 [Oryza sativa (japonica cultivar-group)]
Score 631
Evalue 5.00E-179
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9551
TTTTTTTTTAGAAAATCCCTCGACATAACAAGCAGCAACACTGATTCCATGATTCACGAGACAATATATTGAACAGCCAAAACCAACAAACGATGCATTA
TCCATGAGATCATGACTGCGGCTAAGACACAGATAGTAAATTAAGCAGAAGTACCAAGGCAGATATTACGCCTCAAGACAGTCAAAAAAAGAAGATACCA
CAGCCGTTTTACCAGAACAGAGGCCACTAAAACAAGATACATAATCTAGCTAGAGTAGCTGAACCCTGAGATCTTGTAGATGCGGATAGTTCCATCGGTG
TAACCAGCGTAGAGAGTGCTGCCATCCGCGCTCCAGCTCAAGCAAGTGCAGTAGAGCATCTGCTTGGTGGAGACAGGGACCTCGGGCCTAAGGTCCTGCA
CGATGTGCTTTGACTCAAGATCCCAGATCTTGATGGAATCCTGTGTCGCCGCGCAGAGCCAGTAGCGGTTGGGCGAGAAGCAAAGTGAGTTGATAATGGA
TCCCGCATCCAGCGAGTAGAGTCTCTTGCCCTCGGTCAAATCCCACAGCAAGGTGACGCCATCCTTGCCACCAGACGCGCAGAGCGAACCGTCTGGGCTG
ACTGCAACGGCACTAACATAGCCGCCATGACCATCAAGAGTGCAGCGGAGCTTGCAGTTGGTAAGGTTCCAGACCTTGACAGAGCGGTCCCATGAGCCCG
AGACGATGGTCGGGGCGAAGTTGTTGGGTGAGAAACGGACGCAGGACACCCAGCCGGTGTGGCCCTCGCCACCTCCAAGGTCACCGCCGATGGTGTACTT
GCACTCACCGAGGGTGTTCCACAGCTTGATGGTGCGGTCGCGGGAAGCGGAGACGATCTGTCGGTTGTCAATGGAGAAGGCGACGGAGAGGACGTCCTTC
TCGTGGCCGACGAAGCGGCGGGTGGTGACCCCGGTGGAGAGGTCCCAGAGGCGGAGCTCGCCGTCCCAGGATCCGGAGAGCGCGAACTGGCCGTCGGAGC
TGAGGACGACGTCCTGGACAAAGTGGCCGTGTCCGGTGAGGCGGCGGAAGGGGACGCCGTACTCGGAGCTGGAGTCCTGGGTGGCCTGGATGGGGTTGGT
GAGGTCCCAGACGAGCAGCGACTTGTCGCGGGAGGAGGAGACGATGAAGGGCGAGTTGTCGATGGGCGTCGCGATGGCCGTGACCACGTCGTTGTGGCCG
CGCATCACACCGGCGTACACGAGGGACTCCTGCGCGCCGGCCATGGTGGTGGGGCGGGGCGAAGCGAGCGCTAGGGTTTTGGGGGGTGCGGCCTCGTGCC
GAATTCCTGCA
page-top