Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig955  (registered. 2012)
Contig Information
Length 876 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 4
Wh_DPA20 Seed DPA20 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222640362|gb|EEE68494.1|| hypothetical protein OsJ_26917 [Oryza sativa Japonica Group]
Score 415
Evalue 4.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig955
ACGGTAGGTGCTAAGCTTAGCACATCTAAGCATGAAATTTAAGAGTACCAAGTTTTCTCATGGACCAAAACAAGACCACTGTATCAAGACAAGGCAGTTC
AACTCTTTAATCCACAAAAACAGGTCATAAAACAGAAAAGACACATTATCTAGATAAAGCAAAGATGGCCCATTATACCCTTCAAGCAGCAGCAGCATCT
GCACTCTTCTCACCCTCACCACCCTGAGTAGTTGCTTTATTAGCCTCTGCCTCGGCAGCAGCATCCATCTCCTGTGCAGTAGCATCGACATCATCTGTAG
CCGGACGAATCTGCTCCTCCTCTGGAAGTGGCTCTTCAACATAATCATTCTCAAATGCATCATTAGGAACCTGATAAATCCTCATCTGTGGCTTGGCAGG
ATCTTTCACAAGCACATACTTTCCCTCTTCAAACTTCATGCAGATGTCCACAATCGACTTGACAATGCCCCACATGTTTGCAGTGTTGAGGTTGATCTGG
GTAGCAAAATCCCTTGGCTTGTAGCCCATCACAGTGAGTATGGAGTGGTTGAAGTGGTCGCGGGGGTGCACACGTGACACATAACCCAACTTCATCATGT
CAGCACCAGAAAGTAAAGCCTGGGCAGTCCAGCGAGCGAGCTTGTTGGCATTGTTCTTGAGCTCTGTAGCAAGCACAGCACCACGCTGGGACTCGAGCTT
CTGCTTCCAGTCAACACCAGTAATCTTAGGATCAAACTCATTGAGTGCATTAAGCGTGAGGAACTGGCGAGCACCACTGGGATCAACACCAGCAGCATGC
ACTTCACAGCGGGCAATGATNNNAATATCATCATCCAGCTTCCAGCGGCGATAACGGTAGCAAACAGGCGCCGCCT
page-top