Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig342  (registered. 2007)
Contig Information
Length 843 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0272400 [Oryza sativa (japonica cultivar-group)] >gi|34394538|dbj|BAC83843.1| LAs17 Binding protein-like [Oryza sativa Japonica Group] >gi|113610884|dbj|BAF21262.1| Os07g0272400 [Oryza sativa (japonica cultivar-group)] >gi|215736832|dbj|BAG95761.1| unnamed protein product [Oryza sativa Japonica Group]
Score 671
Evalue 6.05886e-79
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig342
CCGCCCTTTCCCCCTTCCGTCCTTCTCTTCTTCCCCCCACCACGAACGCCGCCCAGCTTCTTCCCCCTCTTCCGATTCCTCGTCTCCGGCTTGCCTGCTC
TTCCTCTCGCTCCGGCTCTCCCCCGCTCCCGCATCGCAGGAAGTTATATCTAGTCACTGACCATGAAAACCTCCAGCGAGGTTCCCTTTTATCACTCGTT
GCCCGTACCAGGAGCTCAAGACAGCCTCAAGGATCAGATCCACTCCAAGGTTATGGGCACGATAGGCAATGTCATGAACTCCATTGATCGAAAGGCACTG
CCTCAGCAACTGGAAGGGGCATGGGAAACAGCTGGAAATGTCGTTAACTCCATTGAGTCAAAACTGTCCGGGCAGAAGTCGTTTGATTTTGACGGCGGAA
ATGATTTTCTTGATGGATATGAATGTCCTGATGATTATTGGGACTATGAACAGCACAAGGCACAAAAGCCAGTTAACATTAGAAACCTGCTGGGTGGCAT
AGTTGCTATCATTGGCCGCACTTGCAAAAATGATGGCATTCAACAATCAAAGGACTCTAGTGTCTCATTCTTGGGGTCAGGTAGTGATGGAGATACATCC
TTGCATTCGTCTGTCTATGCGCCAAGTGCTCCTCCTTTGCTGGATGAAGAAGCCCTGAGTTACAATATTTATAGGGTTGTTTTGGAGGCAGAACCACCAG
AATGGCTGCCCGATAGCTATGCTGACTCGTGCATGCAGTGTTCTGCTTCTTTCACTGCCATTACTCGTGGAAAGGCATCATTGTCGATTCTGTGGAGGGA
TATTTTGCAAGGCATGTTCAAAAGGCAGATGTCTTTTGCCAGC
page-top