Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig234  (registered. 2007)
Contig Information
Length 532 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0603200 [Oryza sativa (japonica cultivar-group)] >gi|77551813|gb|ABA94610.1| ABC transporter family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645459|dbj|BAF28600.1| Os11g0603200 [Oryza sativa (japonica cultivar-group)] >gi|215767683|dbj|BAG99911.1| unnamed protein product [Oryza sativa Japonica Group] (no hit)
Score 734
Evalue 6.52747e-76
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig234
GGGGCCTCGAGGGCTCGAATACATCAGCTTGAATACAAACGAGTCAGCGGAAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGA
AGGCTAGCACAAAAGCATCTACGATCGAAAAGGCAAGGCCTCCTGCCTGGGAGCCTCCTAACTACTCCTGGTCATCGGCGGTCTTCGTCACGTGGTAGTA
GACGCCCTCGGTGTAGTAGCAGTAGTCAAAGGTCTCATCTGGCTCCTGGACTCCGTCATCGAGAGGAGGTCGGTGGTGAGCTCGTACGAGGCCGGGATGG
ACGAGGTGATGCGGATCGACGTCGAGGCCGCGGCGATGTACAAGATGAAGATGGTGGCGATGGCGAGTGTACGGGCCTTCCCCGCTCGATTCGGTCCTCG
GGATGGACGAAGTGGACCGTGGCAGTCCTTCTGGGCGTCTTCTCGCGGCGCGGGGAGCACGGTGGTCGCGGCCATGGCGACGGCAGCAGCGGTTTCACGC
GAGGAGAAGANANANANCNAGGGAAAGGGGNA
page-top