Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig229  (registered. 2007)
Contig Information
Length 751 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar protein-sorting protein 33 [Zea mays]
Score 1168
Evalue 3.18152e-126
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig229
ACCTCTATTTTGTACCACGCCGTATAGTTGCCTGTGAGAAGATTCTGGAGGAAGAGAAAGTTCATCAAAAGTTGACAATCGGAGAGTATCCCTTGTATCT
AGTTCCTTTGGACGAGGATGTCCTTTCTTTGGAGCTTGACTATTCCTTGCAGGAATGCCTTATTGAAGGAGATACAAGTTCTGTCTGGCATGTTGCAAAA
GCTATCCATAAGTTAGAGTTTGCCTTCGGGGTTATCCCCAATATTAGAGCCAAGGGTGTAGCATCAACCAAAGCTGCAGAATTGCTGAACCATATGCAAC
TCGAAGACCCGGTCAGCATGGATAATATGGGGATTCCAGAGATAGACACCGTTATTTTGCTAGATAGAGAGGTGGATATGGTGACACCAATGTGCTCTCA
GCTAACGTATGAAGGTCTATTAGACGAGATGTTGGAAATTCATAATGGATCTGTGGAAGTTGACGCCAGCATTATGGGTGCTCAACAAGATGGAAAAAAG
GTCAAGGTTCCACTCAATTCAAGTGATAAGTTGTACAAGGAGATTCGAGACCTCAACTTGCATGTTGTAGTTCAGGTCGTCCGCCAAAAGGCAACGTCTA
TTCAGCAAGATTATGCAGAAGTAAAATCAACGAATACACAGTCGGTTTCTGAGCTGAAGGATTTTGTGAAGAGGTTACACTCGCTACCGGAGATAGCTAG
GCATGTTAACTTGGCACAACATTTGCAATCATTTGCGGCAAAACCCGCATT
page-top