Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig204  (registered. 2007)
Contig Information
Length 867 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Shaggy-like kinase [Triticum aestivum]
Score 913
Evalue 1.53744e-96
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig204
TACTTCTCTAGAACATATTACAGATCAGCCATGGCAATCTCAATTCTCAGGCGAGGGTTAGTACAGGGGAGGGTGAACCGGTTACATTGTCAAGCTTGCA
TCGCAGCATACTACTACTCAGCTACACAGGTCAACAGGGTGGACTGGTCATACATCACGTCTTCCAACAACCATAATATAGTTCATCACGCTCGCATGCC
TGCCCAACCAACATCCCCAGGAGAAATGCGCACTTGTCGATGCAATTCCAACGACTCGTGAGACAAACATCTCATAGTCATGCATGGGGGCTCTGCTTTC
TCGCGTGTTCTGGGATCAATTTTGCCGCAACATCCGCTGGGATTCCTTTCAGTTCCGGGTCCCGAAGCTCATCAAAGAAGGGGTGAACAAGTGCCTCCAC
AGCAGTGCATCTTAGGTTGGGCGAGTACTGGAGGAGCCGAGAGACTANATCAACAGCTTCAGGTGGCATCCTTTTATGGAATACCTTGTGCCATGGGTGT
GCTTTAATCTGTGGGAATTTGAACTCCGTATAATTGGGGTTCATGCATTTAATTTCTTCCCTTGTANGAGTACCAAGGACCTTGATGATTTCAACAAGCT
GGTCCACACCACTTTCACCAGGAAACAGAGGCTGCCCTAGCATAAGCTCAGCAAGAACACATCCAGCAGACCAAATGTCAATGGCTGTAGTGTACTCGGT
AGCACCAAATATGAGCTCTGGAGCCCTATAGTATCGGGAACAAATGTACGATATGTTCGGTTCTCCCTTAACAAGAACTTTTGCACTCCCAAAGTCACAC
AGTTTTCAGCTGGTGAGTGTGTGGGTTTACCAAAAAGATTTTTGCGGCTTGATATCCCTGTGGCAAA
page-top