Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig184  (registered. 2007)
Contig Information
Length 808 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plasma membrane H+-ATPase [Triticum aestivum]
Score 1199
Evalue 9.36012e-130
Total Hit Count 471
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig184
AATCTTCGCCACTGGTATTGCTGTCGATGATGCTACAGATGCTGCTCGAAGTGCTTCCGACATTGTGCTTACCGAGCCAGGTCTCAGTGTCATTATCAGT
GCTGTCCTGACCAGCAGGTGCATTTTCCAGAGGATGAAGAACTACACGATCTATGCAGTTTCCATCACCATCCGTATTGTGCTTGGCTTTATGCTTATTG
CCTTGATCTGGAAATTTGATTTCGCCCCCTTCATGGTCCTTATCATTGCCATCCTCAATGATGGTACTATCATGACAATATCCAAGGACAGAGTTAAGCC
ATCTCCCTTGCCCGACAGCGAGTTTGAGATGATGTCTGCACTGTACCTCCAAGTCAGTATTGTGAGCCAGGCTCTTATATTCGTGACTCGTTCACGCAGC
TGGTCCTTTGTTGAGCGCCCTGGTTTCCTCTTGGTTACCGCCTTCCTTCTTGCACAATTGGTTGCAACACTCATCGCTGTCTATGCCAACTGGGAGTTTG
CAAGGATCAAGGGAATCGGGTGGGGCTGGGCTGGTGTTATCTGGCTCTTCAGCATTGTGTTCTACTTCCCACTTGACATTTTCAAGTTCTTCATCCGATT
TGTGCTGAGTGGAAGGGCCTGGGACAACCTCCTGCAGAACAAGACTGCTTTCACCACCAAAGAGAACTACGGCAAAGGGGAGAGGGAAGCACAATGGGCT
ACTGCACAGAGAACACTCCATGGCCTTCAAGCACCCGAGCCGGCCTCCCACACACTGTTCAACGACAAGAGCAGCTACCGTGAGCTCTCTGAGATTGCTG
AGCAAGCA
page-top