Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig120  (registered. 2007)
Contig Information
Length 767 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0610900 [Oryza sativa (japonica cultivar-group)] >gi|71153749|sp|Q75H77|SAPKA_ORYSJ RecName: Full=Serine/threonine-protein kinase SAPK10; AltName: Full=Osmotic stress/abscisic acid-activated protein kinase 10 >gi|37700316|gb|AAR00606.1| putative protein kinase [Oryza sativa (japonica cultivar-group)] >gi|54400314|dbj|BAD18006.2| serine/threonine protein kinase SAPK10 [Oryza sativa Japonica Group] >gi|108709784|gb|ABF97579.1| Serine/threonine-protein kinase SAPK9, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549124|dbj|BAF12567.1| Os03g0610900 [Oryza sativa (japonica cultivar-group)] >gi|125544846|gb|EAY90985.1| hypothetical protein OsI_12595 [Oryza sativa Indica Group] >gi|125587104|gb|EAZ27768.1| hypothetical protein OsJ_011251 [Oryza sativa (japonica cultivar-group)]
Score 594
Evalue 2.0681e-65
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig120
TTTGCCTACAACACATATACATGGTACAAACATGATGTGACGACACGGGTTACAGATGATCTACCAGTTCTCAAATCAGCAGAGATAGCCAACACAGCAT
TGAAGCAACACAAGGTCACATCCAAAAGGCCAAACCGTTGTACTACAACATTGGAAGTGCAGAGACCAACTACAACAAAGTAACATTTGTGGGCGGGCTA
TCAAGCACCGCGGTACCCTATCCCTTCTGAGTTGAGAGGTTTTGCACTGTCACATAGCATACACTATCTCCCCGCTGCTTTCGACGTCGAGGTCGGCGTC
TGAATCAAGGTCGTCCATGTCGTCGTCAAGGTCCAGACCGTCGTTCAAGAACTGGTTGATCCGGGAACCAGCGGCCGGGATGGTGGCCTCCGCCAGGATC
TGCATGATCTCGTCCATGCTCTGCATCGGCTGTTCAGGCTCCTCATACTGGCTGCTCATGGTGCTGTCGTCCACTAGGTCAGCTGGGAGGTTCTTCAAGA
ACCACGGATGGTTTCTTATCTCCGGGATTGTGATTCTGGTAGCTGGGTTGCCAACGAAAATCTTGGCGATAAGATCTCGACACTCGGAAGATATGTGCAC
GTAATCGGGAATCGAGTACTGCACACTCAATATCCTCTGAATTGTCTTCCTAAAATTTTTGGGCTCATCANGATCCTCAAAGGGATATGCACCAACTANC
ATAACATAAAAGTGTCACTCCACAGGACCACACATCCNCAATCTTTCCATCATATTCCTTCTTCNNA
page-top