Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9526  (registered. 2012)
Contig Information
Length 791 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115457830|ref|NP_001052515.1|| Os04g0347600 [Oryza sativa (japonica cultivar-group)]
Score 241
Evalue 5.00E-62
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9526
TTTTTTTTTTGTCATCAACACAAATGAGATACCATGTGTTGAAATAAAGAACCTGAACCTACCTATGGGGGTTTGAGTCATGATTATTGGGTTAGGGGCC
TGTGGAATTTCTCTCTTGGTGCAACGCATGATCTCTTTTGCTAGTAATTGTTAACAGAAGATGAAGCTACAACGGTGTACAATTAACTAATAATAAACTT
AATAACAACAACTGAGGGGCCTATAGGCTAACATGTCCAGCATGCTCTCTCTATGGGGAGCATGGCGATTCACTCCGATGGACAGACAGCATGACTCACG
ACACCCGCCTCCTTGTGCTGCGCCTTACTGAGCTTGAATCGACCAGCCTTCTCACAGACGAGGGCTGCGGAGTGGACAGCCCCACTGATTCTGGGATGTC
AAGGTCATCATTTGCCGGCAGGCCCGACATATCGTTATGCTTCTGGAACAAGTCGTGCAGCGGCTCGACTTCGATCCTCACTTTCTCCACCAGCTCCTGG
TGATAAGCGCGAGAACGAGCTTCAGCCAGTCTTCTCTGCAGATCGATCTCTTTCTTACTTCCATATTCTGAATTCTCCATTTCATTCTCCTTTTCTTCCA
GTTCTCGATATAACTCTGTAAATACCGACAAGATCCAGATTTGTGTTGGGATGTCATAAAGTGTCTTAGCTAACGTCAACGATGACTTCAAGATCTCTCT
GGCTTGTCCAGTGTCGTGTAACTGAAGTGCTAATGTACCTAATATTGTTAAATACTGAGAAACCAATTGGATGTTACCCAACTGTTGGTGC
page-top