Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5  (registered. 2007)
Contig Information
Length 841 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Putative Rhomboid family protein [Oryza sativa (japonica cultivar-group)]
Score 666
Evalue 6.41176e-68
Total Hit Count 17
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5
GCACTACATAAGCTTGGACAAATGCAAGCAGGCACTACGCAGTAGCTTCTGCACCTATACAAACTGCATAATCAATGGCACATTTTCCGAAAACCACTCT
GTCACCAAGATCTCCTCTACAAAATCCACTATCCATCCACAGCCTGAACCTAACCTCCAGATAAGCAAGAGATATGCTGCTCGATAACTGCACTCGCTCT
GATATAGAATTGTGTGGCTAATCCCTAATCCTGCTGGCTCATGAGAATCTCAATGGCAACATTTGGATCTCCGTCGGCAGCGGCAAGAGCAACTTCAGCC
TGAGTCCTTTCAAAGCCCATCGCAACCAGCTTCTTAAGCTCTTCATCAAATGTATCAGTCTCGTCAGCTGTTACTGTTGCATCAGCTCTGACAGCGTTTG
CTGCTGTATGCCTAGCATGCAAATTTGCATTGGCCTCCCTTGTAGTTGGTTCAGTTCCTGTAGAAGCAAGCGTCCGCCCTCTCCCTGGAAATCTCGGGTC
TTCTTGTTCCTGACCAGTAGACGTCTGAACAGTGGATGTCCGCCTACTTGGCATCCATGACGAAATATTTCTCAAGAAATTTGCATTTATCAGAGCGCTG
GGTGGAGTGGACATGTTAGAATGTGTAGGAAGCTGGCCGTATGTTGTTCCTCCAGTACAGAGAATAAAGCCAGGACGCCTAACACAAACAGATAGCATGG
ACAAGCCTTCAATAGAAGAGTAAAATGAAGGTCCAGGCAGCAAGTAGTTGAACAGCCCATAAGTGTATGCAAATCCAGACAAGATGCCAGAGAGGTGCCC
CAGTAATGAAACATTACTAGCGAGAAACTGAAACAGTATCA
page-top