Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9515  (registered. 2012)
Contig Information
Length 1180 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242061844|ref|XP_002452211.1|| hypothetical protein SORBIDRAFT_04g021790 [Sorghum bicolor]
Score 561
Evalue 7.00E-158
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9515
TTTTTTTTTTCAATAAATGCGATGCATCATTATTATATTGCTTTGATCCCTCATCTTCATACTTGTAGGAGCAAATATTCTCTTACATGACAGTATTTTA
TTAATGCTCTATTGGTGGAAAATCACCGAGTCGCAAACACGGGGATACGTTGCAAAGAGGCAAACCATTTCTTTTGCAGGGGGAAGCTAGACTTACGGAC
CCTGTGTTTTCCCAGTATAGCATTCTGGAGTTCATGTCGTCTTCATAAAAGTGGAACCTAGGATGATGATGATGTCTTGCCATCCAACGTCAGTAGCACT
TTGTATAGATCAGGACGCCTGTCCCTGAATATCCCCCAGCCGTGTCTCGTAGATTTGATCTCGTCCAAGTCAAACTCTGCCACGAGCACCTCCTCGTCTT
TGTCATTTGCAAGCTTCACGATTTCTCCAGTTGGCCCTGCGATGAATGAGTTCCCGTAGAATTTTATGGTGCTGTTCCCATGCTCAGTCTCGACAGTTTC
CTTTCCTATCCGGTTAGAAGCAACAAGAGGAACCAAGTTAGCACCGGCATGGCCTTGCATGACACGCTTCCAGTGTTCGCGGGAATCCAGGTTCATATCC
TGGGGTTCAGAACCAATAGCAGTGGGATAGAACAATATCTCCGCCCCCTGTAGCACCATAGCCCTTGCGGTCTCTGGAAACCACTGGTCCCAACAAATTC
CAACACCAATTGTTGCATACTTGGTTTTGAAAGCCTTGAATCCAGTGTCACCCGGGTTGAAATAAAATTTCTCTTGATAACCTGGTCCATCTGGAATGTG
TGATTTGCGGTATAGGCCAAGATCGGTGCCATCAGCATCAATAATGGCCACGGAATTGTAATGAGCATTGCCCGCTTCTTCAAAGAAACTTACAGGTATT
ACAACATCCAACTCCTTTGCAAGCTTTTGCATTCTCATTATAGTCGGGTTCTCTTTATAAGGCTTGGCACGCCCAAAGAAATCCATCCTTTGAGCCTGAC
AGAAATAGTGCCCCTCAAATAGCTCCTGAATGAGGACAATGTTCGCGCCTTTCTTATGAGCTTCTCTAATCAACCTCTCGGCGGCGGCGACGTTGTCGGC
CACCGTGTCGGTGCAGGCGAACTGCACGGCGGCGACTGCCACCTTCCTCCCCGCGCCGGCCATCTCCCCTCCTCACCTAC
page-top