Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16290  (registered. 2007)
Contig Information
Length 767 bp
Clones 566 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 566
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain A, The Crystal Structure Of Wheat Non-Specific Transfer Protein Complexed With Two Molecules Of Phospholipid At 2.1 A Resolution >gi|5821925|pdb|1BWO|B Chain B, The Crystal Structure Of Wheat Non-Specific Transfer Protein Complexed With Two Molecules Of Phospholipid At 2.1 A Resolution >gi|11513629|pdb|1GH1|A Chain A, Nmr Structures Of Wheat Nonspecific Lipid Transfer Protein >gi|250226|gb|AAB22334.1| non-specific phospholipid transfer protein, nsPLTP [Tricum aestivum=wheat, var. Camp Remy, seeds, Peptide, 90 aa] >gi|228895|prf||1814270A phospholipid transfer protein
Score 498
Evalue 1.39464e-48
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16290
ttttttttttaGTCACACGCTGAACAGAACGAGTTGTATGTATTAAAGTCCATAAAC*ACTGGGAAGTGCCCATGG*TACAAACT*CT*CAACT*CTC*A
*GGTA*CACAG*A*TACTG*AT*CT*CCTCCAG*A*GG*AGTACCAGCAAGCCAGCTGG*AG*AG*AG*TT*CTTATTCATAT*T*CAGTATAAACTCGC
ATAACTAGTGAC*CATACTACATAGGGATA*G*AGGCTGC*GCGCTTCAACT*CCAC*GTGG*A*TGGATGAGCTGAGC*ACCAGCTTGACGGATCGTCG
CCCATTACACCCTGCTGCAGT*C*GATGT*TGA*GACTGATGGTGTATGGGA*G*GT*TGACACC*GCACTTGGGGGGGATGCTGCGGGC*GTTGTCCTC
GTTGAGATTGTGGATGCCACGAGCGATCCCCTTGAGGCAGTTGCAAGCGCTTTG*GCGATCGCT*CTGGGATCGCGCCTGGTTATGGA*GGTTCTTGAC*
GCCGTCGCAGCACT*GCCCAGACGGGCC*GGGGCC*GCCCTG*AACGTAGCTCAGGCAGGGTCTCACCAAGCTGTCAACGTGGCC*GCAGTCGATGGCCA
CG*GCAGCGCGCGGGACCGCCGCGAGCATGAGCACCAAGGCGACGGCCATGAGCATTACCTGAGCGCGGGCCATGATCAC*TT*C*TTGGT*CTGTAGCT
AACAGTGCACC*GTATTAG*CTAGTGATGATT*GGGTGGAGAGATGAGCCTCGTGCcgaattcctgc
page-top