Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16288  (registered. 2007)
Contig Information
Length 1724 bp
Clones 243 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 39
Wh_SL Seed DPA30 34
Wh_dL Crown of seedling 25
Wh_e Seed DPA10 24
Wh_f Spike at flowering date 20
Wh_h Spike at heading date 22
Wh_oh Pistil at heading date 18
Wh_r Root 12
Wh_yd Spikelet at late flowering 23
Wh_yf Spikelet at early flowering 26
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 1774
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16288
agGAATTCGGCACGAGGCGCCGCCGCAGG*C*TTTGACCCCATCGCCCCTCCGT*CCTCTTCGTCTCCGGTAGGCCAGGTAGTTAACAGCTCCAGCAGCC
ATGGG*AAAGGAGAAGATCCACATCAGCATTGTGGTCATTGGCCATGTCGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGC
ATTGACAAGCGTGTGATTGAGAGGTTTGAGAAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGC
GTGAGAGGGGTATCACCATTGATATTGCTCTGTGGAAATTCGAGACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTG*ATTTCATCA
AG*AACATGATCACCGGG*ACCTCCCAGGCTGATTGTGCTGTGCTTATCATTGACTCCACCACTGGTGGTT*TTGAGGCTGGTAT*CTCCAAGGATGGCC
AGACCCGTGAGCACGCTCTCCTTGCTTTCACTCTTGGTGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCGAAGGC
CCGTTATGAAGAAATTGTCAAGGAAGTCTCTTCATACCTGAAGAAGGTTGGTTACAACCCTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTCGAGGGT
GACAACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCCACCCTTCTCGAGGCCCTGGACCAGATCAATGAGCCCAAGAGGCCCTCAGACA
AGCCCCTCCGTCTTCCCCTTCAGGACGTGTACAAGATTGGCGGCATTGGAACTGTGCCAGTGGGCCGTGTTGAGACTGGAGTCATCAAGCCAGGCATGGT
TGTCACCTTTGGTCCTACTGGCCTGACCACTGAGGTGAAGTCCGTTGAGATGCACCATGAGTCTCTCCTGGAGGCGCTTCCT*GGTGACAACGTCGG*CT
TCAACGTCAA*GAACGTGGCTGTCAAGGATCTCAAGCGTGGGTACGTCGC*TTCCAACTCCAA*GGACG*ACCCTGCCAAGGAGG*CTGCCAACTTCACC
*GCCCAGGTCATCATCATGAACCACCCC**GG*CCAGATCAGCAACGGGCTATGCCCCGGTGCTGGACTGCCATACGTCCCACATTGCTGTCAAGTTTGC
TGAGATCCAGACCAAGATCGACCGGCGGTCTGGCAAGGAGATTGAGGCGGCGCCCAAGTTCCTCAAGAACGG*TGATGCTGGGTTCGTCAA*GATGATCC
CCACCAAGCCCATGGTGGTGGAGACCTTTGCCCAGTACCCTCCCCTGGGCCGCTTTGCTGTGCGTGACATGAGGCAGACGGTTGCCGTGGGTGTTATCAA
GGCTGTGGAGAAGAAGGATCCGACCGGTGCCAAGGTGACCAAGGCTGCGGCCAAGAAGAAATGAGATGGTGTCAGGTTCTTTACTGCATCTATGGTGGCG
GTGGCGGTATTTGGTGGTGGTGATAGTTGTTCTAGTTGTTTTGGAAACTTGTTAAGCTTCGGTTATTTGTGTCGAGCAGTGTTGGAACTGCTTATTGCT*
CTGTCATTGTATCGTT*CGGTTGTGTTGGTGAAACTTCGT*CAGTTAATGTTGCTACTATATATAGTTGGCATGTTTGGAGTCGTTTTATATCAGTTGAT
CATGTTTTTCGTCTaaaaaaaaaa
page-top