Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16285  (registered. 2007)
Contig Information
Length 1081 bp
Clones 210 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 38
Wh_SL Seed DPA30 14
Wh_dL Crown of seedling 24
Wh_e Seed DPA10 20
Wh_f Spike at flowering date 14
Wh_h Spike at heading date 28
Wh_oh Pistil at heading date 6
Wh_r Root 31
Wh_yd Spikelet at late flowering 21
Wh_yf Spikelet at early flowering 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii]
Score 764
Evalue 3.19706e-84
Total Hit Count 439
Registered year 2007
Contig Sequence     [ Download ]
>Contig16285
cgtcgcatatttttaggcaacggcatgccaaacctctggagaaaatccgccaacatagcattaacccagataagacaacccaaatgatgaccaaaaatcc
taaactactcttctcccactacaataaaccagaaaatgcagaagagtcaaaccacaaataacccaaaccaattcattcataGAGATAGGGCGGATGAG*C
AAACCGgcaATCTAAGTTCCAGCCAC*CACT*CAGTT*CCAATTCCAAAGGGTATTATAATAG*AG*ATAGATAGATAGATAACAAAGTACTAG*CAGCA
CCTCGAG*CATTCGGTGTAAAG*AACACACAAATCTGG*ATCA*AACTTGTTTCACCCAACAG*ATATCTTGATGCCTATGTATGTGTATCTCAAACACC
CAG*AAGCACTAG*ATACCAAGTATCGCAGGTAGGCA*ACCACGCACAGCTGCTTACT*TGCCACCACCGATTTCCTTCACAGCGCAGATCTGTTCTTCA
CCC*ATGGCGGACATCACAGACAGGATCAGGTCC*TTGCCATCAGCAAATCCAGTCTTGATCTGGCCAAGCAGAACATCATCAGTGGGAAGCTTCAGGTC
ATCCTTCGTGTTGCCACTCTCAGTTAGAAGGCT*GACATATCCATCATCAGTTATGTCAATCA*GC*TGATAATCTTGGCGGTCAACATGGGGG*ACGTC
ACA*G*TTGTGGG*ATGAAGGAACGATATCCTCAAGCTTCTTTCCATTAAAGATGTCAATGGCAACAAAGTG*ACACTTT*GCGTGACCATGCTT*CCCA
GT*CTTGG*AGGTGGAGA*CCTCAACAACC*TTGCAGGG*ACGGG*CC*TTGATGACGA*TGTGTCCACCCTTGCGGATGGCGCCGGCCTGCTGAGGG*T
AGGTC*TTGGAGGCGCCCGGAGTCGGCCTTGGACTCG*AAGTGGTGCTCAT*CGGTGTCCGACAT*CTCCG*ACGATCCT*CC*TGGGTCCCGGGGGCAA
GTGGGGTGGTGGAG*ACGAGATGCAGCGGCAGCG*AGGGGCGGATGGATGGATCCGGAGGCTAGGGTT*CTTGGTACgccc
page-top