Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16279  (registered. 2007)
Contig Information
Length 2288 bp
Clones 179 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 25
Wh_SL Seed DPA30 24
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 25
Wh_f Spike at flowering date 28
Wh_h Spike at heading date 10
Wh_oh Pistil at heading date 15
Wh_r Root 2
Wh_yd Spikelet at late flowering 21
Wh_yf Spikelet at early flowering 20
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 1035
Evalue 0
Total Hit Count 378
Registered year 2007
Contig Sequence     [ Download ]
>Contig16279
aacgaaacgaaaaacgttactactacacccaataactcacgaggccggcactgacaccttgaatgaattattggagtggttgcacgaatcagaaatgcag
aagataggatcagaaacaaggaagataaggatgaagaatcaaatagttctcttcaatcgaagaaaagaatcaattcgTGCTTGTATTCCTCGCGCAGTAG
TTTATTCCTGCGCGTACGAGATGATCAGAAGATAGGCCAGGGGAAATGAGCACACTGGTCGCTTGTC*AACACACTGCAACTTGG*CACAGAGT*AACAC
TAATTATAACAAAATGACACTCGTTATAGG*AAAAA*TAATG*CTTATTTATAAGTT*CGAG*ACAGCTTTTCCCCAG*AAGTACGCTCATTGTGGCAG*
ACGCAGCAAACCACCTAG*AGCTAATAGTTTATTCAG*AG*AGCAATAGCCTGGCCGGCTGCTTCACAGTAACCAAACGACAAACTGACAGTCAG*AACA
AATTCCACAG*ATGG*AATAGCGACAGCAAATCATGTCTTCACT*CGCACAGCACCGCGCCCTCTTCCAGAGAATCCTCCTCCGCCCGCCATGCGAGG*A
GGTTGGCGAGCTTGCCTTCCTTGACCAGAGGGTGGCTGTGCACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGACAGCAAC
CTCTTCGTTCACGGTAAAGCTCTGGTAGATGAGGAC*GCCTCCACAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCGGCGTCGAGCTT
CTTGCCCCAGGTGGC*GGCGTGGCCCGCGGCCACCAAAGATGGTGACCGCCGCAGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCT*CTTG*ACGAT
GT*CGCCGTAGGCCAGGGCGG*AGGCGTCCATGCCCATGACCTCGTAGCTCGCATAGCTGAAGCC*GTCCTCGGGGGTCACATGG*ATGGTGGAGACGGC
AG*ATCCGTTGATGGCGTTCATGG*AGTAGCCCGCAGGGCTCGAAGTCGAAGTCACAGACCTCCATCTCGGGAATGATGTCGGAGATACCAGAGAGCTTG
GTCATCTCCTTGGCGCAGGAAACGTGGCTATCAGCTTGAGTCTTGAAGAAGACAGAGGCCTTCTT*CTTGTCCAGCCCAGTCATGCACATCTCCAGGGTG
ACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTGCCACTTCTGGCCAGGCTTCGCTGGGTCTCCGATCACATAAGCATTGCCGCCAGACTTCA
GGTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTCAGAGAAGCT*CCTGTGGGGAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCACGAGAGTACT
TCACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTCAAGAATCCTAGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTT
CTGAGAGTAGATGAACAGGCTCGACTCAGATAGCACATAGGAGTCGAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACA
GAGTCAATCTGGGCCCTGGAGAGGGCGCGCAGggcCACGACCATGAGGGTCGGCAAAGATTGATGCCTCGGAGAAGGTGATCT*CGAGGCGCTTC*TCGT
AGCCCTCAAACCCGATCGCAGAGGTCGGGGCAGCCATTGTTGCAGTTCGAGTCAGAGAGCAGAGCAGAGAGGAACAGAGGGAGAAAGACTAGAGAACTGG
TCGATTATCGTGAAGCAGCAAGCCAGAGAGATTGGTGGGAGAAAAGAGTCAG*AATAAAATTGCATAAAAATCCTAAACTACGAGAAGGGGATGCCAAAA
ACGATATCAGGATGGCTTCTTCGCGCAGTTCGA*GTATGCAGCAGAGAACTT*CTTGGCGCCT*CCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGG
GGTGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTTTGACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTA
ACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGAT*CTCAAGAATTCCCTCTCTCCCGACACAGAT*CTCGAGCCCTCCCGACGAGTTCTTCTCTC
TCTTTTTTT*CTTCTTAT*CTAGCTGCGGCGGTGGTGGCGGCGGCGAG*ACGGTGGGGGTGGGAGGAATT*CTT*Cctcgtgccgaat
page-top