Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16269  (registered. 2007)
Contig Information
Length 1231 bp
Clones 152 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 21
Wh_SL Seed DPA30 20
Wh_dL Crown of seedling 19
Wh_e Seed DPA10 10
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 15
Wh_r Root 16
Wh_yd Spikelet at late flowering 17
Wh_yf Spikelet at early flowering 22
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.80302e-132
Total Hit Count 435
Registered year 2007
Contig Sequence     [ Download ]
>Contig16269
ttttttttttagaggtTGCAAACTTTCCAT*CTTCAAACTTTGAAGATAAAGCAATTTTTCAGATAATGCCTAAC*CTTTAT*CTGAAACATATTAGATA
ACCAG*ATGAGGTCTCGAAATAGCACTTAATAAGGTAAACAT*CCACATTACAT*CTAGCAGCAAC*CACG*AGTTCGCAAAT*CAACAAACAT*CAGGC
AAAA*CTTAAAAACGACGGTTCC*AGG*AACATAGGTCTATAT*C*CTTGAAGATAACTGGCTATAG*CAA*AACGACTCAACGC*CTCAGAAT*CAGGC
C*TTGGCAGCA*GC*CTGGGCAG*CGGCATCCC*GCTTCC*TCTGCT*CCTCAATGATGGTGAG*CTTGATACCC**TTGCCCTTGGGGA*GGCTCACCC
ACGGCTTGGTGCCC*TTGCCGATGGTGAA*CACGTTGCCCAGACGGGTGGCAAACTGGTGGCCCTGCGCATCCTCAACGTGGATGGTCTCGAAGGTTCCC
TTATGCTTCTCCCTGTTCTTGATCACACCAACACGCCC*AGTGTTGCGCCCACCAGTAACCATGACCACATTG*CC*GACGTCAAA*CTTGATGAAGT*C
AACAA*T*CTTGTTGGT*CTCCAGGTCGAG*CTTGATGG*TGTCATTGGCCTTGATGAGTGGGTCTGGGTAGCGGATGGTGCGG*CCATCAT*AGGTGTT
CA*GGTAGGGGATGCCCTTCTGGCCGAACTGGACAGACCTGACCTTGCAGAGCTTGAACTTAGCATCCTCATCCCTGACAGAGTGAAGGCGGAAGCGACC
CTT*GGTGTCATAAAGAAGCC*TGTAGTTCTCACCAGTCTTGGGAATGGAAA*TGAT*GTCCATGAACCCAGCA*GGG*TAGGTCTT*G*TCAGTGCGGA
CCTTTCCATCAACCATGATATGACGCTGCATAAGGATAGATTGCACTTCACGGTAGGTGAGAGCATATTTCAGTCTGTTCCTCAGGATGAGGATCAGAGG
CAGGCACTCCC*TGGCCTTGTGAGGACCAGATGATGGCTTGGGGGCAAAAGCTCCACCAAGCTTGTCAAGCAT*CCAGTGAGACGGGGCATTGAGCCTCT
TCAGATGCTTCTTCAAACCCCTAG*CCATGGTTGCGAGCTCGGGCTAGGTCGCCGTGCTTCTCCT*CTTCGGGCACCGCCGCCGCCTGCTCCTTACT*CC
TGTT*CTACGCGCCgcctcgaacCGAattcc
page-top