Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16267  (registered. 2007)
Contig Information
Length 903 bp
Clones 149 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 26
Wh_SL Seed DPA30 18
Wh_dL Crown of seedling 14
Wh_e Seed DPA10 9
Wh_f Spike at flowering date 17
Wh_h Spike at heading date 14
Wh_oh Pistil at heading date 1
Wh_r Root 20
Wh_yd Spikelet at late flowering 21
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin A-1 [Triticum aestivum] >gi|13925737|gb|AAK49428.1|AF262984_1 cyclophilin A-3 [Triticum aestivum] >gi|156193317|gb|ABU56010.1| cyclophilin 5 [Dasypyrum villosum]
Score 834
Evalue 2.25411e-87
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16267
ttttttttttaATGGATAATTCATAGCGGAGTTCATCTCATTCAAACGGTAAGATAGCAGCAG*ACACAGG*AAGATAACCAAGG*CGGCCGG*ACAGAG
*ATCCAGCAGC*CCAAAG*AGTCCACCTAAAACCCTCCTAAACCAACCACGG*AG*ATCTCATCGGACGGACCAGGGG*AAGACACGACACGACACACGA
CTCTCTTATTTAGATCGACGACACGACACGGGACACACGGGGC*GGCGACGACGACGGCGAAAGGCGACCCGCGCGCGGGCGGATCTAGAGCTGGCCGCA
GTCGGCGATGACCACCTG*CTTGGAGCAGGTGCCGCTGCGGGAGCCCACCTTCTCGATGTTCTTGACGACGTCCATGCCCTCGACGACCTCGCCGAAGAC
CACGTGCTTGCCGTCGAGCCAATTGCAGGGGACGGTGCA*GATGAAGAACTGGGAGCC*GTTGGTGTTGGGCCCC*GCGTTGGCCATGGAGAGGATCCCG
GGCTT*GGTGTGCTTGTGGACGAACTT*CTCGTCGGC*GAACTT*CT*CGCCGTAGATGGACTCGCCGCCGGTGCCGTTGCCCCGGGT*GAAGTCGCCGC
*CCTGGCACATGAAGTCGGGGATCACGCGGTGGAAGGCGCTGCCCTT*GTAGTGCAGCGGCTTGCCGCTCTTGCCGACGCCCTTCTCGCCGGTGCACAGC
GCGC*GG*AAGTTCTCCACCGTCCGCGGCACCGCGT*CCTTGTACAGCTCCATCACGATGCGCCCGGCCGGCGCGCCGCCGACGGTCATGTCGAAGAACA
CCCTCGGGTTGAGCCAtgcTCGCTCGCCGGgcaTCGGGgcaTGAGGGCTAGGGTTTTGAGAATGGGGATTT*C*TGTGGGGATTGG*ATtaccc*tcgtg
ccg
page-top