Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16266  (registered. 2007)
Contig Information
Length 2047 bp
Clones 143 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 30
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 13
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 8
Wh_h Spike at heading date 14
Wh_oh Pistil at heading date 6
Wh_r Root 19
Wh_yd Spikelet at late flowering 25
Wh_yf Spikelet at early flowering 17
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pyruvate kinase, cytosolic isozyme [Zea mays]
Score 2544
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16266
ttcggcacgagggcATCGCACTAGGTCTCGGTCATTCCTCTCTCTCTCTCCCTTGCTTGGGGAAG*AAGAAGAAGAAGAAGAG*AGGGCAAGCGCCCCCG
CCTCCCGACGCCGTCGTCCCTCGCCGCCGATCTGATCTCAGGAGCCAGCGAAGATGCATTCCACCAATCTGCTCCTCGAGGAGCCCATCCGGATGGTCTC
CATCCTCGAGCCATCCAAGCCGAACTTCTTCCCGGCGATGACGAAGATCGTGGGGACGCTGGGTCCCAAGTCCCGGTCCGTTGAGGCCATCTCCGCCTGT
CTAAAGGCCGGCATGTCTGTGGCCCGTTTCGATTTCTCGTGGGGGGATGCCGCGTACCACCAGGAGACACTCGAGAACCTCAAGCTCGCCATCAAGGCCA
CCAAGAAGCTATGTGCTGTTATGCTCGACACTGTTGGCCCTGAGTTGCAAGTGGTGAACAAGAGTGAAGTCACAATCTCGCTTGAAGAGAACGAGTCTGT
TGTTCTCACCCCTCACCAGGGCCAGGAGGCCTCTTCCAAGTTGCTCCCTATCAACTTCGCTGGACTCGCCAAGGCTGTGAAGCCCGGAGCCACAATATTC
GTTGGGCAATATTTGTTCACGGGCAGTGAGACTACATCAGTTTGGCTGGAGG*TTTCTGAAGTTCAAGGGGATGACGTGGTTT*GCGTGATCAAGAACTC
AGCTACCCTGGCTGGGTCACTCTTCACATTGCACTGCTCCCAGATCCATATCGACATGCCCACGCTGTCTGATGAGGATAAAGATGTTATGAAAAAATGG
GGTGCTCCAAACAAGATTGACTTCCTCTCTCTTTCTTATACAAGG*CACGCAGAAGATGTGCGGCAAGCACGGGAGTTCCTCTCTAAGTTAGGTGATCTT
AGCCAAACTCTGATTTTTGCCAAAATTGAGAATGTGGAGGGCTTGAACCATTTTGATGAGATCCTGGAGGAAGCGGATGGTATCATTCTGTCAAGAGGGA
ACCTTGGAATTGATCTTCCACCTGAAAAGGTGTTCTTATTTCAGAAGTCTGCTCTGCACAAGTGCAACATGGCTGGAAAGCCTGCTGTTGTTAC*TCGTG
TTGTGGACAGTATGACGGACAACCTAAGGCCTACTCGTGCGGAGGCAAC*TGATGTGGCAAATGCGGTGCTGGATGGTAGTGATGCCATTCTCCTTGGTG
CCGAGACTCTCCGTGGGTTGTATCCAGTTGAGACTATTTCAACAGTGGGCAGAATTTGTGCTGAGGCTGAGAAGGTCTTCAACCAAG*ATTTGTACTTTA
AG*CGAACTGTGAAATATGTGGGAGAACCCATGACCCACTTGGA*GTCTATTGCTTCCTCTGCAGTGCGGGCTGCTATTAAAGTTAAGGCTTCGGTCATC
ATTTGCTTCACCTCATCTGGACGGGCTGCAAGGCTAATTGCCAAGTACAGGCCCACCATGCCTGTCCTCTCTGTTGTCATTCCTCGTCTGAAAACAAATC
AATTGAAGTGGAGCTTCACAGGTGCATTTGAGGCAAGACAATCACTCATAGTTAGAGGTCTCTTTCCCATGCTTGCCGATCCACGTCATCCGGCTGAATC
TACTAGCACTACAAATGAATCAGTGTTGAAGGTTGCTCTTGACCACGGCAAAGCATCT*GGTGTGATCAAGTCGCATGACCGCGTCGTCGTGTGCCAGAA
AGTGGGAGATTCCTCTGTCGTGAAGATCATTGAGCTGGACGACTAGGCAAAATTAGCCTTTGCTCAGGGCTTGCCAGATTTTTGACTAGGCCAAAACGTT
GCTTGGTGGCTATGTATAATTCTATCTATAGTTTTGCAAAACGAGCAGTTTTT*CCTATGGTGTCATCATAGGATCCGCGGTTACCATTCTAAAACCTAC
GCTAGTTATTATGGATATGTCCTCAGATTTTACTGCAGTGTAGCGAGTAAATTAT*CTGATGGAATAATGATATCAAAACTTTGTGACCCTtg*ctattg
ttgtcgctaagcctatgttcccatttacagatncctgagggttttag
page-top