Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16262  (registered. 2007)
Contig Information
Length 1453 bp
Clones 133 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 17
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 22
Wh_e Seed DPA10 36
Wh_f Spike at flowering date 12
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 6
Wh_r Root 19
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1519
Evalue 8.85342e-170
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16262
tttTGCTTCAAGAGAAAAACAAGTTGATTCTAATCAGGTGTCAAATTGTTTCACTCTTGCAGCAAATGTACTGTCCTGTAAATCATCAGGCAAAAGGGGA
GCTACAAG*CCTCATT*CATACACACTTGG*AAAACCAGCGAAAAGGAGCATGCATCGCGATGTGCGGCTGTTCTGGGTGGAGACGAGAGTTTCTAAAGA
GCGGAAGGTTTCATTTATTCAAAACATCCAG*AGGAGCAGCTGCCCTTCGAATGTGGATT*TACGCCAGGCATGAGTAGGCCAACGCCTTCTCCTCTGAC
AGCT*CCTGGGCGGTCGCATCCATCTTCTTCCTCGAGAACTCAT*CGATCGGGAGCCCTTGAACAATTGTCCATTCACCACCACTGCACGTTAC*TGGGA
AGGAGTAGATAAGACCAGCAGGCACACCGT*ATGAACCATCAGAGTACACACCCATGGAAACAAATGTTCCCTgtgatccacaaactcagcgtgttaaaa
ggctgcatgtaaataagccaaataccaaaaaggtccaagggcttaaacagacctcaGCGGTTCCCAGAACCCAGTCACGGATGT*GATCACAAGCTGAGC
TGGCAGCAGAGAGAGCACTGGAGAGCTTCCTCGCTTTGATGATTGCAGCACCACGCTGCTGGACAGTGGCAA*TGAACTCCCCGTTTAGC*CATTCATCA
TCTTGAACAAGTTCACGAACAGGCTTCTCTCCACTGGA*AGTCTTCACAGTGGC*GTGGTTAACATCAGGG*TACTGACTGGACGAGTGATTACCCCAGA
TAATAGCATTCTT*CACGTCA*GAAACTTGGACACCAAGTCTCTCAGAAATCTGACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAACAACT*GATGTT
CTTCTCAGGGATAGATGGAGCAAACTCCTTCAGGATGAGAGCATTGGTGTTTGCTGGGTTGGCAACAACCAAAACCTTGCAGTTGGGGGCTGCATGAGCT
TCAAGAGCAGATGCTTGAGCTTTGTAGATTGAAACATTTTTCGTCATAACATCCTTCCTTTCCATTCCTTCCTTCCTGGGGAATCCACCAACCATAACCG
CAACATTCACACCAGTGCAGGCCTCGACAACATCAGTTGTTGCAACAACTCCCTTGAGAAGTGGAAATGCGGCATCGATCAACTCCATCTTGACGCCTTT
AAGAGCTTCAGCAGCAAATTCAATATCCAGCATATGCAGAATAACAGGCTGGTCTGCACCAAGCATAACTCCCCTGGCAATCATGGGAACAAGAGCATAT
CCGATTTGTCcctGCGGCGCCGGTGACGAGCACGCGCATCGGTTCCTTCGCCGCCATTGGAGCCGGGGGGTAGCTT*CTGGACACGGGGAT*AGGGAGAG
TGGTTTAGGAGGAGGCGacgacaacgggagagatagtgagacgaggcgaatgg
page-top