Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16260  (registered. 2007)
Contig Information
Length 1068 bp
Clones 131 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 16
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 9
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 21
Wh_r Root 2
Wh_yd Spikelet at late flowering 14
Wh_yf Spikelet at early flowering 40
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 359
Evalue 3.65996e-32
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16260
ttttttttttgccatgggaCACAAACAACAG*CTTAAT*CTAACATTACCCAGACTGATATTAT*CA*CAATGTTAGCCGGTGACAATGG*ACGG*AAAG
AGTAAC*CAACCATCTAGGTACAAGCAGGGG*AGCACCCGGCGGCAG*AGGACA*TACACCCTCCGCCGCCAGGGCACCACCCCC*GCCGGCGTCGGCGC
CAACAGGG*AGCGCTGTCCGTTATAGCAGGCAGCGGGACGACGACAAG*AAAAAAAAGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAACTC
TAGTGGAGATGG*ACAGGCTCCTTATGACACCACCGCACACAGCTCACGTCGG*TTCTCGCGCAGCAGCCGCTCCCGCCTTTGTCCGCCGGAGCCAGCAG
CCTTGACAAGATGCGTCTTCTTCACTCGTCGTCGTCCTCGTCCTCATCGCTACCCTCATCGTCATCGTCGTCATT*GATCTCCGACTTGGACTTGTCGGA
TTCCTCCTCATCTTCCTCCTCCACCTCCTTGGCGG*CC*GCCTTCTTTGGGGCGGCAGCAGCAGCACTCTCGCCCTTGTTGTAGGCGGCGATGGCCTTGT
TGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACGTAGGGGGCC*TTCTCCGATTCGCTCAAGCTCTTCCACCTCTCACCGGCCGCTTTGCCGACGGCGG
CGACGGACTTGTT*CTTGGGGTTCTTCTGCTTGAACTCCTCGCGGAACTCGCCCATGAAGACGAAGAAGGCGGAGGGCGCCCTCTTGGGCTTGTTGGGGT
CCTTGCCGGCCTTGCCCTTCTTCCCCTTGGCCGCCGGCTTCTCCGCCCCCTTGCTCTTCACCGCCAACTTGGTGTCGGCCTTGGCGGCGCCCTTGGATTT
GGCCCCCTTCATGGCTGGTGGGTTTCCCTGCGCCGAAAAACACGAAATCAGCGAGCGCACGGGCCGGATCCGCGCGGGGCGGGCCGGAATCGGGCGGACC
GGCGGCGGATCGGCGGCGGATCGACGGAGAATCGAGGCTCACCTGGGTGGGGAGGGAGGGAGGGCGct
page-top