Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16257  (registered. 2007)
Contig Information
Length 2020 bp
Clones 123 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 26
Wh_SL Seed DPA30 14
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 9
Wh_f Spike at flowering date 16
Wh_h Spike at heading date 20
Wh_oh Pistil at heading date 5
Wh_r Root 15
Wh_yd Spikelet at late flowering 8
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase [Triticum monococcum]
Score 1975
Evalue 0
Total Hit Count 375
Registered year 2007
Contig Sequence     [ Download ]
>Contig16257
ttcggcacgagggttgcacAAG*AATTCCTCCCACCCTCGCCGTCTCGCCGCCGtgcACCACCGCAGCTAG*ATAAG*AGAAAAAAAG*AG*AGAG*AAG
*AACTCGtgcGGG*AGGGCTCGAG*ATCTGTGTTGGGAGAGGGGAATTCTTGAGGTCGGAATCGGAACAAGCGGGCGCGCTCGGGATCGGGGTTACCATA
CAATTTTTCCCAGG*AACCTTT*AGTGAATGTGCTAATGGAGTCAAAGGGTGGCAAAAAGTCTAGCAGTAGTAGTTCCCTGATGTACGAAGCTCCCCTCG
GCTACAGCATTGAAGACGTTCGACCTGCTGGAGGCGCCAAG*AAGTTCTCTGCTGCATACTCGAACTGCGCGAAGAAGCCATCCTGATATCGTTTTTGGC
ATCCCCTTCCCG*TAGTTTAGGATTTTT*ATGCAATTTTATTCTGACTCTTTTCTCCCACCAATCTCTCTGGCTTGCTGCTTCATCTGTT*CCTCTCTGC
TCTGCTTTCTGACTCAAAACTGCAACAATGGCTGCCCCGACCTCTGCGATCGGATTTGAGGGCTACGAG*AAGCGCCTTGAG*ATCACCTTCTCTGAGGC
ATCAA*TCTTTGCTGACCCTCATGGTCGTGGCCTGCGCGCCCTCTCCAGGGCCCAGATTGACTCTGTTCTTGATCTTGCACGGTGCACCATTGTGTCCGA
GCTCTCCAACAAGG*ACTTTGACTCGTACGTGCTATCCGAGTCGAGCTTGTTTATCTACTCTCAGAAGATTGTGATCAAGACCTGTGGGACTACCATGCT
CCTGCTCACCATTCCAAGGATTCTCGAGCTGGCTGAAGAGCTGTGCATGCCGCTTGCTGCTGTGAAGTACTCCCGTGGGATGTTCATCTTCCCCGGTGCA
CAGCCTGCTCCCCACAGG*AGCTTCTCTGAGGAGGTTGATGTCCTGAACCGCTACTTTGGCCACCTGAAGTCTGGTGGCAATGCCTATGTGATTGGAGAC
CCAGCGAAGCCTGGCCAGAAGTGGCACATCTACTATGCCACCGAGCAACCTGAGCAGCCCATGGTCACCCTGGAGATGTGCATGACTGGGCTCGACAAGA
AGAAGGCCTCTGTGTTCTTCAAGACTTCTGCTGATGGCCATGTCTCCTGTGCTAAGGAGATGACCAAGCTCTCTGGTATCTCTGACATCATCCCTGAGAT
GGAGGTCTGCGACTTCGACTTCGAGCCCTGCGGCTACTCCATGAACGCCATCAACGGAT*CTGCCTTCTCC*ACCATCC*ATGTGACCCCCGAGGACGGC
TTCAGTTACGCGA*G*CTACGAGGTCATGGGCATGGACGCTTC*GGCCCTGGCCTATGGCGACATCGTCAAGAGGGTCC*TCCGGTGCTTTGGCCCTTCA
GAGTTCTCAGTGGCGGTCACCATCTTCGGTGGCCGCGG*CCATGCCGCCACCTGGGGCAAGAAGCTCGACGCCGAGGCATACGACTGCAACAACGTTGTG
GAGCAGGAGCTCCCCTGTGGAGGCGTCCTCATCTACCAGAGCTTTGCCGC*GAACGAAGAGGTTGCTGTCTCTGCCGGGTCGCCCAGGTCCGTCTTCCAC
TGCTTCGAGGCCGAGACTGTGGAGAGCCACCCGCTGGTCAAGGAAGGCAAGCTCGCCAACCTCCTCGCATGGCGAGCGGAGGATTCTCTGGAGGAGGGCG
TGGTGCTGTGCGAGTGATTTGCTGTCGAATGTTCAGTCTGTGGAATTTGCTCTGACTGTATGTCTTTTGTCGTTTGGTTACTGTGAAGCAGCCGGCCAGG
CTATTGCT*CTCTGAATAAACTATTAG*CT*C*TAGGTGGTTTGCTGCGTCTGCCACAATGAGCATACTGTTTGGGG*AAAA*GTTGT*CTCAACTTATA
AATAAGCATTTTTTTT*CTAGGACGAGTGTCACTTTGTTATTACTACTGAATTCCTTTCTGCCTGTATCATATTCATATTCTGTAAT*GGAGTTACTAGA
TGCCAAgtttaaaaaaaaaa
page-top