Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16251  (registered. 2007)
Contig Information
Length 2446 bp
Clones 112 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 27
Wh_SL Seed DPA30 22
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 13
Wh_r Root 11
Wh_yd Spikelet at late flowering 16
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 3082
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16251
ttttttttttgcaagcaatagcacagaattaTAGAAATATAGCTAACATATAATAG*AACCAACAATAACGA*ACTGTTCCACG*AGT*ACCACAAACAG
C*TAGCCGCGCTTAATGTTTGGCCAGCCAAAAGACAAAACCGATACAGCGACCATCCAACGTCGACACTAAAGATAAAAACAACTAGGCGGTGCAGGGCA
TGAACATCCGACGACAGGCAGACTTGGCGCTTAGTCGACCTCCTCCATCTTGCTCTCACCAGCGTCGTCCTCCAGGGGCGGCATGTCGGTGTCGTTCTCA
GGCGCCTCATCGTCCTCGTCAATGCTCAGGCCAAGCTTG*AG*CATGCGGTGGATCCTGGTGCC*GAAGGTGTTGGGGTCCTCCAGGCTGAAGCCGGAGG
TGAGCAGGG*AGGTCTCGAAGAGCAGCATCACCAGGTCCTTGACTGACTTGTCGTTCTTGTCGGCGTCGGCGCGCTTGCGGAGCTCGT*CCATGATGGCG
TTCTCA*GGGTTGATCTCCATGGTCTTCTTGCTTGACATGTAGCCAGCCATGCT*CGAGTCCCTCAAGGCCTGGGCCTTCATGATCCTCTCCATGTTGGC
GGTCCACCCATACTCGCCAGTCACCAGACAGCAAGGGGAGTCCACAACACGGTCAGAGACGATGACCTTCTCCACCTTGTCGCCCAGCACCTCCTTGATG
ACCTTGCACAGCCCCTCGAACTTCTCC*TTGAGCTCCTCCTGCTTCTTCTT*CTCGTCCTCGCTCTCATCGAGCTTCAGACCCTCCTTGGTGGCAGAGAC
AAGCTTCTTGCCCTCAAACTCCTTGAGCTGACCAATGGCATACTCATCAATGGCGTCAACCATGTAGATGACCTCATAGCCCTTCTTCTTCAGCTTCTCA
AGGAAGGGAGAGTTCTCCACAGCCTTCTTGCTCTCACCGGTGATGTAGTAGATCTCGTTCTGTCCCTCCTTCATCCTAGTCACATAGT*CCTTGAGGCTC
GTCAGCTCATCACCACTCTTGGTGGAGTGGTACCTCAGAAGCTCAGCAATCTTGGTCCTGTTCTGGGAGTCCTCGTGGATGCCAAGCTTGAGGTTCTTGG
AGAAGGCCTCGTAGAACTTGTTGTAGTCCTCCTTGTTCTCAGCAATCTCAAAGAAGAGCTCAATGCACTTCTTGACAAGGTTCTTCCTGATGACCTTGAG
GATCTTGTTCTGCTGGAGGGT*CTCACGGGAGATGTTCAGGGGAAGGTCCTCTGAATCAACAATGCCCTTGACAAAGCTCAGGTACTCAGGGATCAACTC
CTCACAGTTGTCCATGATGAAGACACGGCGCACATACAGCTTGATGTTGTTGGCCTTCTTCTTGTTGTCGAAGAGGTCAAAGGGGGCCCTCTTGGGCACA
AACAGGACAGCCTTGAACTCAAGCTGGCCCTCAACAGAGAAGTGCTTGACAGCCAAATGCTCCTCCCAGTCATTGGTCAAGCTCTTGTAGAAAGCAGCAT
ACTCTTCCTTGTTGATCTCCTCTGGCTTCCTCATCCAGATAGGCTTCTGCTTGTTGACCAAGTTCCACTCATGAGAGACTT*CCTTGATCTTCTTTTTCT
TCTTTTCCTTCTCTTCCTTCTCCTCATCAACATCCTCAACCTTGCCCTCCTCAGTATCCTTCTTCTCCTCCTCATCTTCATCGTCAGAAATTTCCTT*CT
CAGTGGTCTTCTCGGTCCACAGGGAGATGGGGTAGCTGATAAACTCAGAGTGCTTCTTAACTAGATCCTTGATGCGGCGCTCCTCAAGGTATTCCATCTG
GTCGTCCTTGAGGTAGAGCACCATCTTGGTACCCCTGCCGAGCTGCTCCCCAGACGTATCACGAGTGACGGTGAAGGAGCCACCGGCCTGAGACTCCCAC
ACGTACTGCTCGTCGTCGTTGTGCTTGGTGGTGACGACGACCCTCTCGGCGACGAGGTAGGCGGAGTAGAACCCAACACCGAACTGCCCAATCATGGACA
CGTCAGCGCCGGCAGCGAGTGCCTCCATGAACTCCTTGGTCCCCGACCTGGCGATGGTCCCGAGGTTGTTGACGAGGTCCGACTTGGTCATGCCAATGCC
GCTGTCGACGATCGTGAGCGTGCTGGTCGCCTTGTCGGGGATGATGTGGATGAAGAGCTCGGGCTGCGCATCGAGCTTGCTCTTGT*CCGTGAGGCT*CT
CGAACCTGATCTTGTCCAAGGCATCGGAGGAGTTGGAGATGAGCTCGCGGAGGAAGATCTCCTTGTTGGAGTAGAAGGTGTTGATGATGAGCGAGAGGAG
CTGGTTGATC*TCGggcCTGGAAGGCGAAGGT*CTCGGT*CTCCGTCGCccaTGGCTGCGCGCGT*CCCTGAGCTG*CTCGAGGCGGAGGAGAAGCGTGC
GGGAGGCGGCTAGG*GTTAG*CCTCGtacccgAATTTCCTGCagcc
page-top