Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16250  (registered. 2007)
Contig Information
Length 925 bp
Clones 111 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 20
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 10
Wh_e Seed DPA10 7
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 10
Wh_r Root 8
Wh_yd Spikelet at late flowering 12
Wh_yf Spikelet at early flowering 24
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 359
Evalue 2.81037e-32
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16250
ggaGGACAACAGC*TTAATCTAACATTACCCAGACTGATATTATCACAATGTTAGC*CGGTGACAATGG*ACGG*AAAG*AGTAACCATCTAGGTACAAG
CAGGGGCACCCCGCGG*AAG*AGGACATACACCCTCCAC*CACTAGGGCATCCCCGCCGGCGGCGGCGCCAACAGGG*AGCGCTATCCGTTATAGCAGGA
CAATGACAGGAAAAAGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAATTCTAGTGGAGATGGATAGGCTCCTTATGACACCACCGCACACAG
CTCAGGT*CCGTTCTCGCACAGCA*GCTCCCGACTTGTCCGC*CGGAGCAGCCTTGACAAGATGCGTCTTCTTCACTCGTCATCGTCCTCGTCCTCATCG
CTGCCCTCATCGTCATCGT*CGTCATTGATCTCCGACTTGGACTTGTCAGATTCCTCC*TCATCTT*CCTCC*TCTACCT*CCTTGGCCGCAGCCTTCTT
TGGGGCAGCA*GCAGCAGCGCTCTCGCCCTTGTTGTAGGCAGCAATGGCCTT*GTTGTACTCGCCC*TTGAGCTTGTTGGCCTTGGCCACATAGGGGGCC
TTTTCCGATTCGCTC*AAGCTCTT*CCACCT*CTCACCGGCCGCTTTGCCGACGGCGGCGACGG*A*CTTGTT*CTTGGGGTTCTT*CTGCTTGAACTCC
T*CGCGGAACTCGCCCATGAAG*ACGAAGAAGGCGG*ATGGCGCCCTCTTGGG*CTTGT**TGGGG*T*CCTTGCCGGCCTTGCCCTTCTTCCCCTTGGC
GGCCGGCTTCTCCGCCCCCTTGCT*CTTCACCGCCAACTTGGCGTCGGCCTTGGCGGCGCCCTTGGATTTGGCCCCCTTCATGGCTGGTTT*CCTGGGgg
gagagggcgggggagagagggcgct
page-top