Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16249  (registered. 2007)
Contig Information
Length 908 bp
Clones 109 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 26
Wh_SL Seed DPA30 15
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 11
Wh_f Spike at flowering date 10
Wh_h Spike at heading date 15
Wh_r Root 4
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii]
Score 764
Evalue 2.45362e-84
Total Hit Count 460
Registered year 2007
Contig Sequence     [ Download ]
>Contig16249
ctgcaggnaatTCGGCACGAGGCATCCAtTCCGCCCCTCGCTGCCGCTGCGTCTCGTCTCCACCACCCCACTTGCCCCCGG*ACTCAGGAGGATCGTCGG
*AGATGTCGGACACCGA*TGAGCACCACTTCGAGTCCAAGGCCGACTCCGGGCGCCTCCAAG*ACCTACCC*GCA*GCAGGCTGGCGCCATCCGCAAGGG
TGGACACAT*CGTCATCAAGGC*CCGTCCCTGCAAGGTTGTTGAGGTCTCCACCTCC**AAGACTGGGAAGCATGGTCACGCA*AA*GTGTCACTTT*GT
TGCCATTGACATCTTTAATGGAAAGAAGCTTGAGGATATCGTTCCTTCATCCCACAACTGTGACGTCCCCC*ATGTTGACCGCCAAGATTATCAGC*TGA
TT*GACATAACTGATGATGGATATGTCAGCCTTCTCACTGAGAGTGGTAACACTAAGGATGACCTGAAGCTTCCCACTGATGATGTTCTGCTTGGCCAGA
TCAAGACTGGATTTGCTGATGGCAAGGACCTGATCCTGTCTGTGATGTCCGCCATGGGTGAAGAACAGATCTGCGCTGTGAAGG*AAATC*GG*TGGTGG
CAAGTAA*GCAGCT*GTGCGTGGTTGCCTACCTGCGATACTTGGTATCTAGTGCTTCTGGGTGTTTGAGATACACATACATAGGCATCAAGATATCTGTT
GGGTGAAACAAGTTTGATCCAGATTTGTGTGTTTTTTACACCGAATGCT*CG*AGGTGCT*GC*TAGTACTTTGTTATCTATCTATCTAT*CT*CTATTA
TAATACCCTTTGGAATTGGAACTG*AGTG*GTGGCTGGAACTTAGATT*CCGGTTTG*CTCATCCGCCCTATCTCtatgaatgaattggtttgggtttaa
aaaaaaaa
page-top