Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16248  (registered. 2007)
Contig Information
Length 601 bp
Clones 109 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 109
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-thionin
Score 318
Evalue 8.05412e-29
Total Hit Count 142
Registered year 2007
Contig Sequence     [ Download ]
>Contig16248
gcCTCGTGCCGAATCGGCACGAGGCAGAAGCCCTAGCTTGTTCCACCTAAAG*AGAACCAACGGCTTTGCTCCATCCACCCACCTACCCCCACAG*AAGC
AAATGG*AGTTCAAGCCGAAGGCGACCGTGTGCGCGCGTGATGCTGGTGCTGCTCCTGCTTTCCTCATACGACAGCGGCGGCGTCGGCGTGGCGGAGGCG
CGCATTTGCA*CGGGGAAGAGCCAGCACCACTCGTTCCCGTGCATCTCGGACAAGAGCTGCACCAAGACGTGCCTCAGCGAGCACGG*CGCAAAATGGAC
GGCCGGCTACTGCAAATTCAGGCGCTGCACCTGCCAGAGGGAGTGCTAGGGCAGACGCT*CC*GCGCGGCGAGCTCCACCACCCCCGCCCGTCCATGGCG
CCGCCAGTCACCTATGTATCTTAACTACCATGTACCCACTCGCCGCCT*CTGTCGGGTGATGTAATAAAACGTGGCGCGCACCCGCCGGCGCGT*CACC*
GGTGTACGTAGCATGATGCATGCCACGCGTTGCTTCCAGTGATAAAATCAATGGATTACTCGTACGATCTCTTGCGTGCTCGGTAGCAtggaaaaaaaaa
a
page-top