Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16246  (registered. 2007)
Contig Information
Length 744 bp
Clones 104 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 33
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 5
Wh_r Root 15
Wh_yd Spikelet at late flowering 18
Wh_yf Spikelet at early flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acidic ribosomal protein P2 [Triticum aestivum] >gi|32400824|gb|AAP80644.1|AF475123_1 acidic ribosomal protein P2a-2 [Triticum aestivum]
Score 312
Evalue 5.55368e-27
Total Hit Count 331
Registered year 2007
Contig Sequence     [ Download ]
>Contig16246
tttcccactcaacgatgtgccaatttacaaagaatTCTGTATTAGGTTCACCAAAACACTAGCAG*AAAAATGGGACAGCGATTTAAGGATACATGGAAC
AGGCAGAACATCAAAACAACGCATTGTTAAAGGACCAAAATTGGATAGCAAAGGTATGGTTCACCAGTAAATCAACCAGCAACCAGGGGCTGAATTACAT
ATCAAAACATTGTCTTGCCAGTGTTTCACAACTCAGCTAAATAAAGGCTAAAACATCATTGACTCTAGTTTCCTGGCCAAGGATAGATACTTCAG*ACAC
AA*GGTGCCCCACAACTTAGTCGAACAGACTGAA*GCCCATGTCATCATCACTCTCTTCCTTCTCCACGACCTTCTCTTCTTTCTTTGACTCAGCTGCAG
GGGCAGCAGCACCTCCAGCAGCAGGGGCAGCAGCTGAAACAGCCACACCACCACCACCAGATGGAACC*GCAGCAAACTTCTCCCTACCAGCAGCCAAGA
G*CTCGGTGATGTCCTTGCCC*TTCACTTGGGACAGCATGAGTTCCATCTTCTCATTGTCGATTTCACAACCAACAGACTCAAGAATGGATGTCAGGTCC
TCTGCAGAGGGGCT*GGCGTTGCCAGAGAGGTAAGCAAGCAGATAGGCAGCA*ATGAACTTCAT*C*TTGGATCGGAGAAGGAAGGAGAGAGCTGAAGGC
GGGGCGGCGGCGGAGGG*CTCGACCGAT*CTGCTAGGGTTTCtc
page-top