Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16236  (registered. 2007)
Contig Information
Length 1517 bp
Clones 95 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 14
Wh_dL Crown of seedling 13
Wh_e Seed DPA10 17
Wh_f Spike at flowering date 20
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 2
Wh_r Root 13
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Fructose-bisphosphate aldolase cytoplasmic isozyme; AltName: Full=Gravity-specific protein GSC 233 >gi|41398198|gb|AAS05825.1| fructose 1,6-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878379|gb|AAT85154.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878433|gb|AAT85207.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|125594188|gb|EAZ34247.1| hypothetical protein OsJ_017730 [Oryza sativa (japonica cultivar-group)] >gi|169244417|gb|ACA50482.1| fructose-bisphosphate aldolase [Oryza sativa Japonica Group]
Score 1655
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16236
tatgaatgaaacttatcgatagcctttgacagcttagaacaaagcaagaaaaggtgacggaACACATGTGTACTCGCATATGAGGTTTGAACATTGTATG
AGCAGGAAAATTACAGGACCATGG*AACAAAAACCTGCTCCAATATACGATACGCAGCACCCGATTTCCAGGGTACTTCAACTCCAAAAAG*AAA*CTAC
TACGGTATTATGAAAACACAAGTTCCATATTATTAAAAACGATGTTCGATATCCAAGG*ATATATCA*GGACTCAG*AAAACCAAACAATGATACTGGTA
AGCGGGACGCCCAAACGGGCCACAGCTCCGAAGGCAGATAGATCA*GTACTTGTAGTCCTTGACGTGGAGGCTCTCAGAGGCGCCCTCGCCAAGGGTGGC
GTCGCCCTTGTAGGTGCCAAGGGTGGCCTCGGAGTTGGCCTTGCACCTCACCAGGAACGCCGTCCTGGCCTTCTCCTCGTTCTCCGTCTTGCCGGACCAG
GCCTTGAGGGTGCTCTGCTGGAGGGCACGCCCGAAGGAGAAGGACAGGTTCCAGGGCTTCTTGGTCTGGAGCTTGTTCATGGCGTTCAGGTTCAGGGTCG
CCTCCTCCTCACTCTGTCCACCGGAGAGGAAGACAATGGCGGGGACGGCAGCAGGGACGGTCCTCTGG*AGGGTGCGGAC*GGTGTACTCAGCAATCACC
TCAGGGGCCACCTTCTT*GGCGTCGGATCCAGGGGTGACCATGTTGGGCTTCAGG*A*GGGTGCCCTCAAGGAGGACATGCTGGTCGTTGAGGGCCTTGT
AGCAGGCAGCAAGGACGATCTCAGT*CACGTAAGCACAGCGG*TCAATGTCATGAGGTCCATCAACAAGGATCTCAGGCTCAACAATGGGCACCAGCCCA
TTCTCCTGGCAGATGATGGCATAGCGAGCCAGACCCT*GAGCGTTCTGGTCGATGGAGAGCTGTGATGGCTCGGTGGCGCCGATCTTAAGGACTGCACGC
CACTTGGCGAAGCGGGCACCAGCCTCATAGTACTTGGCGCAGCGCTTGCCAAGGTCATCAAAGCCCTGGGTGGTGGTCTCACCGTTGGTTCCAGCAAGCT
CGATGGTACCCTTGTCCACCTTGATTCCGGGGAGGACATTGCCCGCCTTGAGGATGTCGACGAAGGGCTTGCCACCCTTGGTGCTCTGGTACAGGGTCTC
CTCGAAGAGGATCACACCGCTGAGGTACTGGA*GGGCACCAGGGGTGCAGAAGAGGAGCT*CACGGAGGGCACGGCGGTTGTCCTCAACGTTCTCAACAT
TGATGCTGGCGAAGCGCTTGCCGATGGTGCCGGTGGACTCATCAGCAGCGAGGATACCCTTGCCAG*GGGTGCCAATGTAGGCAGCGTT*CTTGATGAGC
TCATACCTTGTACTTGCCGCAGTAGGCCG*ACATGGTCGATGCT*CGGGGG*AG*ATT*CGAGGGCTGCGACGGGag*attggggg*ttggcaggcaggg
gagggagggaggcctcg
page-top