Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16233  (registered. 2007)
Contig Information
Length 560 bp
Clones 91 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 91
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Gamma-1-purothionin >gi|100843|pir||S11529 gamma-purothionin - poulard wheat >gi|157831231|pdb|1GPS|A Chain A, Solution Structure Of Gamma 1-H And Gamma 1-P Thionins From Barley And Wheat Endosperm Determined By 1h-Nmr: A Structural Motif Common To Toxic Arthropod Proteins >gi|227202|prf||1616227A purothionin gamma1
Score 283
Evalue 6.63821e-24
Total Hit Count 220
Registered year 2007
Contig Sequence     [ Download ]
>Contig16233
ttttttttttaggaCACGGAACGGAACGTGAACCGTACGTTTTATTCTTATTATTATACCTTAG*CCCGCCCATGCATGCATCGAT*CGAG*A*TGCAGC
AGCTGGCTGGCTAGTGATGACACGG*ACATACATACGACATACGTACGTAGAAAGGGGCACACACATTCAAGTAGGTACACAGACGTATGGTTCCATGGG
CTAGCTAGCTGACGTACGGCGAAGGCCAGCTAGCCGTAGCACATATGATCAGCACTGCCTGATGCACTTGCACCGGCGGAAGGGCCCGTCGCAGTTGCCG
CCGCCCCAGCCTTCTTGCTGGCAGACTTGCGCGCAGTTCTTATTGGACATGCACGGCCCCTTGAACCCGGCGCTGCGCCGCCGGCAGATCTTCGCCTCCG
CCCCCGGCACCGCCGCCTCCTGTGCGATGAGGAGGAGAAGCAGGACCAAAACCACCTGCGTCGCCACCTTCTTGGT*CCACATTGTGAACGGCCGGGCTG
GGAGCG*ACCTAAA*CTCTGCTTGCGCTACGTACTGGCTTTGCTACTGGTGGAGTTGTgc
page-top