Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16230  (registered. 2007)
Contig Information
Length 1616 bp
Clones 88 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 20
Wh_e Seed DPA10 7
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 6
Wh_r Root 9
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07959 [Oryza sativa Indica Group]
Score 431
Evalue 2.92084e-40
Total Hit Count 371
Registered year 2007
Contig Sequence     [ Download ]
>Contig16230
ttttttttttgGCTTTTCAACCGAGCACCAAACTAAAGCTGAAGGCACATAATGTAGAACCATTTTCATT*CTAAAAAGACCATCCCAAGGTGGTTTGCA
GTACTCATTGCACAG*ATACTTAGGTCTCAACAG*AATTACATATCAAATCCGCAAAATT*CAAC*CTAAAAG*CACATAAG*ATAGGTAATCTTTAGCA
TAGCAGATTCCACAGG*AGAGCTGGAATTGAACTGCTTAGTCAAACAA*GCTGAAG*CCCATGTCATCATCGCTCTCTTCCTTGGCCTCCTCCTTTTTCT
CTTCTTTCTTCTCTTCAGCGGCAGCAGCACCACCAGC*AGCCGGGGCAGCAGCAGCAGCAGCTGGAGCACCACCTCCACCAGATCCGACGGAAAGGATGA
GGTCATCGACGCTCCTCTTCTCCAGGAGCTTGGCGAAGAGCGCGGGCCAGTAGGCCTCAACCTTGATTCCGGCAGCCTTCACCACCGTCGCGATCTTCTC
AGAAGTGATGGGGATCCCGTCATCGTGGAGGATGA*GGGCGG*CAAGGG*TGCAGGCGACC*TCGCTGGAAGACATGGCGACGGATT*CTCACCGGAGCG
GAT*CTGCGAT*CTTGGGGAGG*CG*A*TGG*AAGTGGAGGCGCAagGAGCTGTTCATCACAG*ATGCCCAGCAAACAACTAAAG*CACTTCCTCGACTA
CATCAAAATTTGAATTTACAGCAGGAAGCAACAAAACATCAAAAACTAAAAAGACAAGCTATGCTGAGGAAACAACTAGCCGCTAGGGGAAAACACACTT
GGATCACAGTGCAGATGG*AGGTGAGCAGTGTGACGGAACCATTTGGTCCT***GTATTTCCAAGGCTCTACATGAGCTTCATCAGATCATAATACACCC
GACAACCGCTGCCAGCAACG**TCTCGATT*CTGGGAGAAATAGTTCATCTGGGAGATGAACTCACATTTTCATTTGCAGCTGTACATGGTGGCCTCGAT
CTCTAGCCTCCCTTCCAAGGGCCGTGCAGGAAA*CATGGTGGCCTCGATCTCTATCCTCCCTTCCAAGGGCATGCATCCTGCAAGCATGACTTAACACCT
CCAGCGGCATCAAATATGATGAGGGAATCCGGTGCACCGTTTCAGAAAAAAATGTCTGATATGTGCACAGCTACCCAACAATTTCCCTCGTCAAGCTGAA
ACAGGCAATTGTTCTGTCTTTGACGATAAGGCTCCAACATGTCAACAGACATTAGTTGATTTCTACTTCCTCCACATCTTTACTGCTAGGGAAACTGCAT
GGCTCATCTTCCTCTTCGTCCTCATCTACTTTCATAAATAGTCCAAGTTTTTCCAACATGCTGCCAGAACCAGGAAGAAAACTGGGCATGCCATCCTGGG
AATGCTCAGGACTCGTCTCATCAACAGAACTTACAATATGTTCCGTGGTGATTGTACCAAGCATTTCTAGGTCCTTGGGATGGACGCTGTCATTAATTTC
TACAGTTCTCTCCATCTCCTGCAAGGCCTGACGAGCCTTTTCCCTCTCAAGGTCCCGCTTacgcttggaTTCAGCTTCGGCTTCAGCTCTGCGAGcttgc
caTGGCTGCATTACct
page-top