Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16221  (registered. 2007)
Contig Information
Length 1635 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 9
Wh_oh Pistil at heading date 4
Wh_r Root 9
Wh_yd Spikelet at late flowering 20
Wh_yf Spikelet at early flowering 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0821100 [Oryza sativa (japonica cultivar-group)] >gi|29124135|gb|AAO65876.1| heat shock protein cognate 70 [Oryza sativa (japonica cultivar-group)] >gi|108711797|gb|ABF99592.1| Heat shock cognate 70 kDa protein 2, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550195|dbj|BAF13638.1| Os03g0821100 [Oryza sativa (japonica cultivar-group)] >gi|125588425|gb|EAZ29089.1| hypothetical protein OsJ_012572 [Oryza sativa (japonica cultivar-group)] >gi|215697587|dbj|BAG91581.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2043
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16221
ttttttttttacAGCCAAATTTAAGCTCTAAG*AATTCAGAATGAAATCACAGGTGTAGGTAGTACAAACAATAAG*CATTAAGCTGAAATCAACAATGA
G*CCAAAACATGCATCATTGCATTGTTTACGACACTGATGCTACAG*ACCAAAAGTACAACAA*AACTTCCAGCCCAGGTGATATGATTGGCACCCAGG*
ACTGAATCAAATGGCGTATATGAAAGCGACTAACTTAGTCGACCTCCTCGATCTTGGGGCCAGCACCGCCGCTGGCAGCCGGCGCGTCCTCGTCCATGCC
TCCCGGCATGTCAGCACCAGC*GCCCTGGTACATCTTGGCGATGATGGGGTTGCAGAGGCC*CTCCAGCTCCTTCATCTTGTCCTCGAACTCGTCAACCT
CACCAAGCTGGTT*GGCGTCAAGCCACTGGATCGCAGCGTCGACAGCGTCCTCGATC*TT*CTT*CTTGTCGTCAGCGGGCAGCTTGGAGGCGATCTTCT
CGTCCTGGATGGTGTTCCTCATGTTGTAGGCGTAGTTCTCCAGGGAGTTCTTGGCGTCAACCTTCTTCTTGTGCTCCTCGTCCTCAGACTTGTACTTCTC
TGCGTCCTGGACCATCTTCTCAATGTCGTCCTTGCTCAGCCTGCCCTT*GTCGTTGGTGATGGTGATCTTGTTCTTCTGGCCAGTGGTCTTGTCCTCAGC
AGAGACATTCAGGATACCGTTGGCATCAATGTCGAAGCAGACAGTGATCTGGGGAACACCCC*TGGGTGCAGGCGGGATGCCGGAGAGCTCAAACTTGCC
GAGCAGGTTGTTGTCCCTGGTCCTTGTCCTCTCACCCTCAAACACCTGGATGAGCACACCAGGCTGGTTGTCGGAGTAGGTGGAGAAGACCTGCTCCTTC
TTGGTGGGGATGGTGGTGTTCCTGGTGATGAGCACAGTCATGACTCCTCCAGCAGTCTCAAGACCAAGAGACAGTGGGGTCACATCGAGGAGGAGAAGGT
CCTGCACCTTCTCGTTCCCCTCACCGCTGAGGATTGCAGCCTGCACGGCAGCACCGTAGGCAACAGCTT*CATCAGGGTTGATGCT*CTTGCAGAGCTCC
TTCCCGTTGAAGAAGTCCTGCA*GCAGCTGCTGAACTCTGGGGATCCT*GGTGGAACCACCAACAAGCACGACATCATGGATAGTGCTCTTGTCCATCTT
GGCATCCCTCAGGCACTTCTCCACTGGCTCCATGCACTTCCTGAAGAGGT*CCATGTTGAGCTCCTCAAA*CCTGGCCCTGGTGATGGTGGAATAGAAAT
CAACTCCCTCAAAGAGTGAATCGATCTCAATGGTGGTTTGGGCAGTGGAAGAAAGGGTCCTCTTCGCCCTCTCACAAGAAGTCCTGAGCCTTCTCAAAGA
CCTGGGGTTTCCACTGATATCCTTCTTGTGCTTCCT*CTTGAACT*CTTGGACAAAGTGGTTCACCATACGGTTGTCAAgaccataggcaattgcagctg
ctgttggctcgttgatgatacgcatcacattaagaccagcaataacaccggcatccttggttgcctgcctctgggaatcattgaagtaagcaggcacggt
gacaacagcattgcttaatagttacttcctaggta
page-top