Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16216  (registered. 2007)
Contig Information
Length 1113 bp
Clones 81 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 27
Wh_dL Crown of seedling 10
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 11
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 860
Evalue 3.15328e-90
Total Hit Count 425
Registered year 2007
Contig Sequence     [ Download ]
>Contig16216
gcatgcttgtaattcaaaccaaaaacagctccggcgtccaggcatctaAGGGAGAAAAGTAGGCGAGTACACACAAGTAGCTCCGATGAAGACGGCAGAC
AG*AAGAG*AATAGCAACAGG*AATCCAAC*CACATTGTCTCATTT*CATACGAAG*CAAATAACACT*CAGTAGTAA*TA*CTACGAATCAACTCGATC
TAAGGTCCAAAAACCTCACAGGGCA*GATATGTTATGCTTGCTTTAGCTACGACACCATCACGGCAACAGAAAACTGTAGATATATTGTGCGCCCACCGC
CATCACCTGC*CTCAGGAAGATTTAGATTTTGTTGAAGGCAACAATGTCACAGCTCTGGATGTACTCGTTGGCTGGTTCAACGCAGAGATGGTCTTCAAT
AAGAGTGTCGACAGAGACGAGGTCATCAATGATGGTCATCATAATCTGGAGCTTCTTGATGCCATATCCAACG*GGCATGAGCTTGGAAGCACCCCACAG
AAGGCCCTCCATCTTGATGCTTCGGACAGCTTCCTCCAGCTTGACCATGTCGGTCTCATCGTCCCATGGCTTAACATCAA*GCAAAACTGATGACTTGCC
AGATTCTTTCTTCTTGGTAGAAGCCTTTGCTTTGGCAGCGCGCTCTTCAGCTGCCTTTTTCTCCTCCTCGGTTTCCTCTCCAAAAAGGTCAACAT*CGCT
GTCATCGTCATCATCAGCTGCAGGAGCCTCAGCAACATCAGTAGTTGAGGTTTCAGGGACAACTGATGACAGAACCTTCACACCTTGACCAGGGG*CAGT
AACTCCACTCAGCTTCAGGAGTGCATCAATGTGATT*GTACCACCTTGCAACATTGGTGCAAGTTG*ATGGTGGAGCAACTGAGAACTCTGAATACACAG
CCAAGTCAT*CCTTGGAAGCTTGGTATCCAGAGATGTAACTGCGAGACAGAAGGTAGCCATCAAGCTTTTTAAGGCCTGCCTCAGCATTAACATTGAAGG
TAGCCGCCATCTCAGCCTCAAAAGGATGGAACAGATGATCTACTCGAGGGAGCG*AGTCGAGGTGTGGCCGCGGGGAGGCGAGGAGGAGGAGGAGGACGG
CCCTCGTGCCgaa
page-top