Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16211  (registered. 2007)
Contig Information
Length 790 bp
Clones 77 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 14
Wh_e Seed DPA10 12
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 5
Wh_r Root 6
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleoside diphosphate kinase [Lolium perenne]
Score 750
Evalue 1.01086e-77
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16211
cactacaatttgctgggaagatcatgagtacaatTCTGCTACTAACCCACAAAAAAGTAGGGCAAAGAAATAAtcaaagCACAGCAAAAACATGAAATGC
AACTCAATACCATATATCAAATATAGAGCAGCAGATAACGCTTGCATGCTCAAG*CACAAGG*AG*ATAACTTCAGTTCACACAAACAAGGTT*CCCAAG
*ATACAAATCTCAAAACTGTAAACAACCAAAGACTAGTTTGGTAGATGCTTAATGAAACCTGCACTCAAACCACTCATGACACATCTTATGCCTCATAGA
TCCAGTTGTGCTGG*CTGCTCCTCCACTCTGCAATGCCCTCAGGGAA*CCACAGGGCGATCTCCTTCCTGGCACTCTCAACTGAGTCGCTTCCATGGATG
ACGTTCCTGCCGATGTCGACGGCAAAGTCACCACGGATGGTGCCGGGCTCAGAGGCCAGGGGGTTGGTGGCGCCAA*TGATC*TTGCGTCCAGTGGCGAC
GACGCTCTTGCCCTCCCAGACCATAGCGACGACCGGGCCGGAGACGATGTACTCCACGAGCCCAGCGAAGAAGGGCTTGGAGGACAGATCAGA*GTAGTG
CTGCTCGGCGAACGACTTCT*CCACGTTCTGGAGCTTCAGACCTTT*GAGGTAGAAGCCCTTCTT*CTCGAAGCGGCTGATGACCTCGCCGATGAGGCCC
CTCTGGACGCCGTCAGGCTTGATCATGATGAAGGTCTGCTCGGCCATTGTTGCTGTGCTGAG*CTTGAGATTTCTGATTGGGTTTTGacc
page-top