Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16206  (registered. 2007)
Contig Information
Length 1291 bp
Clones 74 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 24
Wh_e Seed DPA10 48
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-gliadin [Triticum turgidum subsp. dicoccoides]
Score 526
Evalue 2.12347e-51
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16206
ttttttttttcccccctttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
ttttttttttttgACAAGCAATGCTGGCAAACAAGAACTCTGTTTGTCTTTTATTCCCAAG*CTTGAACTAGCACTGGTCGGGGTCACACATG*ATGGTG
CACGCCACTTTATTTGTCATCGTTACATCGAT*TGGTGCAT*CTG*CTAAGTAACGATGATCCATCTAT*CTATTAGTATAGATCTTGCTTTTTTCATTG
GCCACCAATCCCCGCGACTATGCTGGCAAATGGTGCCCTGATGATGCCCTGATGCTGGCAAATGGTGCCCTGATGATGGAGCACTCAGGTGGGACATACA
CGTTGCACATGGTTGGAAGAGTTTGCAACACCAATGACCTGATCGCCTCCAATTGAGCTAGTTGCTGAGGTTGGATGATGCCCTGGCCTTGGACGAGAGT
ACCTTGACCCAACTGTTGTTGTTGAGATAGTGGCAGCAGGATATGCATGCCTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGCTGCTGCTGCACGATG
ATGGAATGCACGACGCTATGGATGGCTGCGCACTGGAGCTGCTGAGGAATCTGTGCTAGTTCTTGGCAGCATTGTTGCTGCATCACTTGGCAATCGCTTT
GTGGCCAGATTATCGACCAGAGGGATGACACCAATGACGCAGGTTTGCATTGTTGCAAGAGGATATTCTTGCATGGGTTCAAACGTTGTTGTAGAGATGG
CTGAATGAAC*GGTCGTTGTTGCTGGGGGAATGATTGTTGCGGTTGTTGGGGCTGCGGGAATTGTTGTTGGGGCTGGGGAAAAGGTTGGTGTGGTTGCTG
GAACTGGGGAAATGG*TTGTTGTGGTTGTTGAGTCTGGGGGAATGGTTGTTGTGGTTGCTGGGGAAATGGTTGTTGTGGTTGCTGAGGCTGGGGGAATGG
TTGTTGTGATTGCTGGGGAAATGGTTGTTGTGGTTGCTGGGGAAATGGTTGTTGTGGCTGTTGAGTCTGGGGGAATGGTTGTTGCGGTTGCTGGGATAAT
GGCTGTTGGGGTTGGGGGACTAGTTGTTGTTGTGGCCATTGTACTTGGCCACTAGGGTCGACCTGCATATTGGCGGTGCTGATGGTTATTGCCATCGCAA
GGATCGTCAGGATGAGTAAGGTCTTCATGGTCGATTTGCGTTAACTACTACGTACTTGGATTTGCtgatttgtgctctaggtgcgtgaagg
page-top