Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16200  (registered. 2007)
Contig Information
Length 1298 bp
Clones 72 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 10
Wh_e Seed DPA10 62
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit LMWGS1 [Triticum aestivum]
Score 231
Evalue 3.42178e-17
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16200
aacgccggtatgaacatTGTCTAGAGAAAACTTTATTTGTATTTTATTCCAGAATTTAACTACTAG*TTTGCGGGTCACACATG*ACGTTTGTGTGACAC
TTTATTTGTCACCGCTACATCGACATATCCATCGACTAAACAACGGTGATCTAACGACTATATATTACTA*GAAATCTTTTCTTATCAGTAGCCACCAAC
TCCAGTGCCAATGCTGAATGGCATAATAGTGGTCGAGCTGTACAACGGCACGTTGACACCGCACATCGTTGGCAAGGTACGGAGTGCAATGGAAGTCATC
ACCTCAAGTTGAGATATCTGGTGTGGCTGCAAGAATATACCCTGTGGTATCTGTTGTTGTTGAGGCTGCTGACCCAATTGTTGT*AGTTGTTGAGGTTGT
TGGAAAGAACACTGTCCGAGTTGCTGCTGCTGCTGCGACTGCTGTTGGTGTTGGGAGACACCTTGGCCCGACTGTTGGGGTTGTTGCTGCTGAGGTTGGA
CAAAACCCTGTTGTTGTTCTTGCAGGATGATGGAGTAGACGATGGCACGGATTGCCTCAGAGCGGGATTGTTCGGGGATTTGCGGCAGCTGTTGGCAACA
TT*GTTGTTGCATCACATGGCAAC*TACTCTGTTGCCACATTT*GT*GACCTAGCAAGACGTTGCGACATTGCCACATGG*CTACACT*GCTGTTGGAGG
AACACCTTGCATGGGTTT*AGCTGCTGCAAAA*CGGATGGTTGAACAACAGGG*ATTTGTTGTTGTGGAAACTGTTGGTGTTGTTGTGGAAAAGGTGGTT
GTTGTGAAGATGGTTGTTGCTGCTGCGAAAATGGTGG*TTGTTGTTGTTGTGAAAATGGTGGTTGTTGTGGTAGAACTGGTTGTTGTTGCTGCGAAAATG
GTGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTGAAAATGGTGGTTGTTGTGGTAGAACTGGTTGTTGTTGCTGCGAAAATGGTGGTTGTTGCAGTAT
AATAACTGGTTGcctGTTGCGGCAGAACTGG*TTGTTGTTGCTGCGAAAATGGTGATTGTTGCAGTATAATAATTGGTTGTTGTTGCTGTGGAAATGGTT
GTTGTTGCTGTGAACATGGTGGTTGTTGTTGTGGTGGTAATGGTTGTTGCTGCCATGGTTTCTCCAAACCAGGGACGCGGCTAGTCTCCATTTGTGCAAT
GGCACTTGTCGCCGCAATGGCAAGGAGAGCAAAGATgcaGGAAGGTCTTCATGGTGGATTGGTGTTAACTAGTattgctcctcgtgccgaattcctgc
page-top