Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16196  (registered. 2007)
Contig Information
Length 797 bp
Clones 69 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_dL Crown of seedling 12
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 26
Wh_yf Spikelet at early flowering 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 470
Evalue 2.94499e-45
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16196
atTCGGCACGA*GG*CTCAGCTTCCACCCACTCTCA*G*CCCCTCCCGCCGG*A*GCCCAAG*CAAGG*AAGCAAG*ATGGACGGCAGCAAGG*CGAAGA
AGGTGGCGGCGAAGAAGTTCGGCGGGCCGAGGAAGAAGTCGGTGACCAAGTCCATCAAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCT
CAA*GAAGGGCCGCTACGCCC*AGCGCGTCGGCTCCGGCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCAGCCGAGGTGCTGGAGCTGGCCG
GGAACGCCGCCAAGG*ACAACAAG*AAGACCCGCATCGTGCCGAGGCACCTGCTGCTGGCCATCCGCAACGACCAGGAGCTCGGGAGGCTGCTGTCCGGC
GTCACCATCGCCCACGGCGGCGTGATCCCCAACATCAACCCGGTGCTGCTCCCCAAGAAGGCCGCCGAGAAGGCTGAGAAGGCCGGCACCGCCGCCAAGT
CGCCCAAGAAGGCCACCAAGTCCCCCAAGAAGGCCACCAAGGCCTAGATCCTAGT*AGTGTGC*GACCGTGCCCGGTGGTGCTCCGGCAGCCCT*CGTGT
GCC*TAGTGTCTGTGTTAATTAAGTTAGCTGTGGTGTGTTCCAGAGAGTGCTCAAGCTTGTACTTTTGCTTTGCCCCGCCATGT*AACCGTGAACG*AAG
AGGAAGCAT*CTTGCTTCCT*CTGTTCTTCTGAATCAATCTGGTCTCTAATGCAGTGTTTGTtaaaatgtcactgaatttctgttctaaaaaaaaaa
page-top