Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16195  (registered. 2007)
Contig Information
Length 1864 bp
Clones 69 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 16
Wh_r Root 12
Wh_yd Spikelet at late flowering 13
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Populus trichocarpa]
Score 744
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16195
gttgttacagactggaagctacaacagttacaggcatagcacagacgcatttcaaagacaccgctgatcgctgtgacccttgaagtagagatcatccagg
cGACGACACCAAACcaaatcacACGAAGAAACAATACACATACTGAAACAGGGAAATGGTGACGGAGCAGTAGATCTATGGTGTAGGCAAACCGGATAAC
ATGCATATTGACCAAGGTGCGAAGCAGGTTCATACAACACAACAGGTTGTAAACCAAACACCACACAGCAAACATTCAATTCAAACAGACAGAAAACAG*
ATAAAGCCACTCGGGCAGATCATCAGGTCGCAATCTCAGCTGCTCTAGTACTCAT*CACCCTCATCACCATCCTCACCCTCGTCGAACTCAGCACCAACT
TCTTCATAGTCCTTCTCCAGGGCAGCGAGAT*CCTCACGGGCCTCAGAGAACTCTCCC*TCCTCCATGCCCTCACCCACGTACCAGTGGACGAAGGCACG
CTTGGCGTACATCAGGTCGAACTTGTGGTCGATGCGGGAGAAGACCTCGACAACGCTGGTGGAGTTGGAGATCATGCAGACGGCCC*TCTGGACCTTGGC
AAGGTCGCCGCCTGGGACAACGCTGGGTGGCTGGTAGTTGATACCACACTTGAAACCAGTGGGGCACCAGT*CCACAAACTGG*ATGGTGCGCTTCGTCT
TGATGGTGGCCACAGCGGCGTTGACATCCTTGGGCACAACATCACC*ACGGTACATGAGGCAGCAGGCCATGTACTT*GCCGTGGCGGGGGGTCACACTT
GGCCATCATGGAGGAAGGCTCGAAGG*CGCT*G*TTGGTGATCTCGGCAACAGAGAGCTGCTCATGGTAAGCCTT*CTCGGCTGAGATCACTGGGG*CGT
AGGAGGAAAGCATGAAGTGGATT*CTTGGGTAGGGCACCAGG*TTGGTCTGG*AACTCGTTGACATCAACATTCAGAGCACCATCAAACCTCAGGGAA*G
CAGTCAGGGATGAGATGACCTGAGAAACGAGCCTGTTGAGGTTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTC
ATTGTCAAGGAGGACAGCCACATCAGTGTGCTCAAGGAGAGAGTGGGTGGACAGGACACTGTTGTATGGCTCGACAACAGAGGTGGAGACCTGAGGGGAT
GGGTACACTGTGAACCCAAGCTTGGACTTCTTTCCATAGTCAACAGAGAGCCG*CT*CCAGGAGAAGAGAACCAAGGGCCAGAGCCAGTTCCACCTCCAA
CAGCATTGAAGACGAGGAAT*CCCTGAAGACCAGTGCAGTTGtgcTGCAAGCTT*CCTGATACGGT*CCAGGCATAGGTCAACAATCTCCTTGCCAATGG
TGTAGTGACCACGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATAAGCTGCTCAGGGTGGAAGAGCTGGCGATAAGTGCCAGTCCTCACCTCATC
AATCACAGTGGGCTCAAGATCAACAAAGACAGCACGGGGGACATGCTTCCCAGCACCAGTCTCACTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCA
ACAGTCTTGTCACCGGGCATCTGTCCATCAGGCTGAATGCCATGCTCGAGGCAGTAGAGCTCCCAGCACGCGTTCCCGACCTGGATACCAGCCTGGCCGA
TGTGGATCGAGATGCACTCCCT*CATGGCGGCGGGTCGGAACGGCGGAAGCGGGCGCTACGC*TACGCTGCTGGAGAGGTCGGGGGAGGAGGACGAAGGA
CAAAGCTCGGAAGCGCGAGAGAGAGGCGAGTACGAAGACGCCGGTCT*CTGCCTCGTGCCGAat
page-top