Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16189  (registered. 2007)
Contig Information
Length 1597 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 14
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 15
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 13
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0163100 [Oryza sativa (japonica cultivar-group)] >gi|34851127|gb|AAO62546.1| actin [Oryza sativa (japonica cultivar-group)] >gi|62732979|gb|AAX95098.1| actin [Oryza sativa (japonica cultivar-group)] >gi|62732980|gb|AAX95099.1| actin [Oryza sativa (japonica cultivar-group)] >gi|62732981|gb|AAX95100.1| actin [Oryza sativa (japonica cultivar-group)] >gi|77548869|gb|ABA91666.1| Actin-7, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|77548870|gb|ABA91667.1| Actin-7, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|77548871|gb|ABA91668.1| Actin-7, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|108864034|gb|ABG22379.1| Actin-7, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|108864035|gb|ABG22380.1| Actin-7, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644534|dbj|BAF27675.1| Os11g0163100 [Oryza sativa (japonica cultivar-group)] >gi|215686339|dbj|BAG87600.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218185309|gb|EEC67736.1| hypothetical protein OsI_35242 [Oryza sativa Indica Group]
Score 1391
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16189
ttcGGCACGAGGCACCGCCGCCACCCACCCCCTCATCCTCTTCCTCCGCTCTCTGCAGCTGCCGCTCATCTCGGTGGGAGGTCCTTAGGCGGGCAGGTTC
CCCTAGATCCCCGGAGTCACTCAATCAAATGGCTGACGGTGAGGACATCCAGCCCCTTGTCTGCGACAATGGAACTGGCATGGTCAAGGCTGGTTTTGCA
GGGGATGATGCACCCAGGGCCGTCTTCCCAAGTATCGTTGGGCGCCCCCGCCACACTGGTGTGATGGTGGGGATGGGGCAGAAAGATGCATATGTTGGTG
ACGAGGCCCAATCCAAAAGGGGTATCCTCACCTTGAAGTACCCGATCGAGCATGGCATCGTCAGCAACTGGGACGACATGG*AGAAGATCTGGCATCACA
CTTTCTACAATGAGCTCCGTGTTGCACCTGAGggaGCACCCAGTACTGCTGACTGAGGCGCCCC*TGAACCCCAAGGCTAACAGGGAGAAGATGACACAA
ATCATGTTTGAGACCTTCAATGTTCCAGCCATGTATGTGGCCATCCAGGCTGTGCTTTCCCTATATGCTAGTGGACGCACAACAGGTAT*CGTGTTGGAT
TCTGGTGATGGTGTCAGCCATACTGTGCCAATCTATGAAGGATATGCCCTTCCACATGCC*ATCCTTCGTCTTGACCTCGCTGGGCGCGACCTAACTGAC
TGTTTGATGAAGATTCTTACGGAGAGAGGTTACTCCTT*CACCACCACCGCCGAACGGGAAA*TTGTAAGGGACATCAA*GGAGAAGCTCGCATATGTGG
CTCTTGACTATGAACAAGA*GCTGGAAAATGCCAAGAGCAGCTCCTCTGTTGAGAAGAGCTATGAGCTGCCTGATGGGCAGGTGATCACCATTGGGGCAG
AGAGGTTCCGTTGCCCTGAGG*TCCTTTTCCAGCCATCTTTCATTGGTATGGAAG*CTGCTGGAATCCATGAGACCACC*TACAA*CTCTATCATGAAGT
GTGATGTGGATATCAGGAAGGATCTGTATGGTAACATT*GTGCTCAGTGGTGGCTCAACTATGTTCCCGGGTATTGCTGACCGTATGAGCAAGGAGATCA
CTGCCCTTGCCCCAAGCAGCATGAAGATCAAGGTGGTGGCACCGCCTGAGAGGAAGTACAGTGTCTGGATTGGAGGGTCGATTCTTGCCTCCCTTAGTAC
CTTCCAACAGATGTGGATCTCGAAGGGTGAGTATGATGAGTCAGGTCCAGCGATTGTCCACCGGAAGTGCTTCTAAGTTGCGAGTTGTCTGGGTCTTC*T
GAATCTATTCTGGCTGTTCTTTTCTCAAGTCCTTGCCATGTAAGCTACTATGTTTGAGATTGCTGGG*ATT*CTGTTGACTGTATTACCGG*ATTAATTT
GTTGGGTCAAAATATGTTCAGTGGGCTGCTATATTTGACCGGTGCTGAATCATATGCCGCATGTTC*TGGTTTTTTTTTTCATGCCAAAAAGTTTGGTGC
TAGCGTGGGGGGA*GTGTCAAACTATCTACCAGAGTCTTTGTAAGATTTTTCCGTGCGAGTCCCATAATCatttccctTGTGTACATTCACTTCTgc
page-top