Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16186  (registered. 2007)
Contig Information
Length 1335 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 9
Wh_yd Spikelet at late flowering 10
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 40S ribosomal protein SA [Zea mays]
Score 1111
Evalue 3.24735e-119
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16186
gagGAATTCGGCACGAGG*CCCGTGCCTCCTCTTCCTCCTCGCTCTCTCGCGCACGGGGCTCGCGTCCGAAACCCTAACCTCCCACCATGGCGGCTGAAG
GCGGTGGCGTCCGGGCGCTGTCCCAG*CGCGAGCAGGACATCCAGATGATGCTCGCCGCCGACGTCCACCTCGGCACCAAGAACTGCGACTTCCAGATGG
AGCGCTACGTCTACAAGCGCCGCACTGACGGCATTTACATCATCAACCTTGGCAAGACCTGGGAGAAGCTTCAGATGGCCGCAAGGGTCATTGTTGCGAT
TGAAAATCCTCAGGACATCATTGTGCAATCTGCTAGGCCCTATGGACAGAGGGCTGTCCTCAAGTTTGCCCAG*TACACTGGTGCTAACGCCATTGCTGG
CAGGCACACTCCTGGTACATTCACCAACCAGATGCAGACTTCATTCAGTGAGCCACGCCTTCTTATCCTGACCGACCCCAGGACTGATCACCAGCCTATC
AAGGAGTCTGCACTTGGAAACATCCCCACCATTGCCTTCTGCGACACT*GACTCTCCTATGCGTTACGTTGATATTGGCATTCCTGCTAACAACAAGGGG
AAGCAGAGCATTGGTTGCCTATTTTGGCTGCTCGCCAGGATGGTTCTGCAG*ATGCGTGGTACCATTCTCCCAGGACACAAGTGGGAAATCATGGTTGAT
CTGTTCTTCTACAGGGACCCAGAGGAAGCTAAGGAGCTTGAGGAAGATGAGGCTTTGGGTGCTCCTGAGTACGCTGCAGTTGCAG*AGTACACTGCCCCA
GCGGGAGATACCTGGGGTGCTGAATGGCCAGGAGCTGCAGCTCCAGCTGCTGCCGTCGAAGCCCCGGCTGGTGCTGAGTGGACTGGTGCTCCAGCTCCTG
CGGCCGATGGATGGGATGCCGTTGCAGCACCTGCCCCTACTGGCTGGGAACAGGGCAGTGCTCCGGCACCTGCAGCAGCACCAGCTGCTACTCAGAACTG
GGAGTGAAGGACTTGACCCAAGGTTTATGCTACTCGGCACTCTGGAGTGAAGGAGTTCG*GCCGTGGTTTATTGGTGAAGGCTGTGTTATTTGCCCCGTC
AGTACTCTGTTGGTAGACGCTGGTTAAGTAGATTTAATTTTTACAGTACTGAGTTATGTTAGATGGAAATCGATTTTTGTCTTCTTGGCTTTGCAGGGGT
TGGGAGTTATCACCCCAGCCTT*CTGTTGCCTCTCATCGAATAGCTTTATTTGAAGTTCCATTTTGCCAGCAAGTGTATGGTCAGATT*C*T*CTTGAAA
TGTTATAAAAGCCCGGATCAtgtataccctagata
page-top