Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16176  (registered. 2007)
Contig Information
Length 1469 bp
Clones 66 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 8
Wh_h Spike at heading date 15
Wh_oh Pistil at heading date 1
Wh_r Root 14
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit UDP-D-glucuronate decarboxylase [Hordeum vulgare]
Score 912
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16176
gagGAATTCGGCACGAGGCGTCCGCCCACGGTCTAATCCGATTCAAACGCACCGCTTCCTCGTGTCCGAACTAAGCCCCAATCCCACCACCACCGCCGCT
GGTGCTCGGCGCGATGGCGCAG*AAGGACGCCGC*CAATGGCAACGGCGCCACCACGCGCCCGCCGCCCACTCCCTCCCCCATCCGCTTCTCCAAGTTCT
TCCAGGCCAACATGCGGATCCTGGTGACCGGCGG*AGCTGGCTTCATCGGCTCGCACCTCGTCGACAAGCTCATGGAGAACGAGAAGAACGAGGTCATTG
TTGCTGACAACTTTTTCACTGGGTCAAAAGACAACCTGAAGAAGTGGATCGGACACCCAAGATTTGAACTCATCCGTCACGATGTCACCGAACCACTGCT
CGTGGAGGTTGACCAAATCTACCACCTTGCTTGCCCTGCCTCACCAATCTTCTACAAGCACAACCCTGTCAAGACCATCAAGACGAATGTCATTGGAACC
TTGAACATGCTTGGACTTGCAAAGAGAGTTGGAGCTAGAATATTGTTGACTTCGACCTCTGAAGTTTATGGTGATCCCCTTGAGCATCCTCAGACGG*AG
GCGTACTGGGGCAATGTTAACCCAATTGGAGTCAGGAGCTGCTACGATGAGGGTAAGCGTGTAGCTGAGACACTTGATGTTCGACTACCACAGGCAGCAC
GGCATTGAGATCCGTATTGCCAGGATTTTCAACACCTATGGACCTAGGATGAACATCGA*TGATGGCCGTGTTGTTAGTAACTTCATTGCTCAGGCCATT
CGTGGTGAAGCACTGACTGTCCAGAAGCCTGGAACACAGACCAGGAGCTTCTGCTACGTCGCTGATATGGTCAATGGTCTTATGAAGCTGATGAATGGAG
ACAACACCGG*ACCCATTAACATTGGG*AACCCAGG*TGAATTCACCATGCTGGAACTTGCCGAGAATGTGAAGGAGTTGATCAACCCAGAAGTGACAGT
GACGATGACTGAGAACACTCCTGATGACCCTCGCCAGAGGAAGCCTGACATCACCAAGG*CCAAGGAGGTTCTCGACTGGGAGCCCAAGGTCGTCCTGCG
CGACGGCTTGGTGCTCATGGAGGACGATTTCAGGG*AGCGTTTGGCAGTGCCCAAGAAGACCAAGGCCTAATCCCCCTCCCTACGTTTGGCGTACAACAT
CACCAATTTGCCAGAGCATACTCATAGTTGGGTGGGTTCGTCAATATTCGTTGCTGCGTTTCGTTACGGAATTTGAGTTCCAATAAACCAATTACACCTT
CGTCGTTCACTTGAAAGATTGTATTATTAGAAACTTCATACAAGGCGTGGCTGTTTGTATTACCGTCG*CTTTTTGCGGAACTTGTGCTCCTTATGTTTT
AGCATATGAACTTCCCTAAATCAATTATAGCAATGTTCGTGCCATTTTGGGTTTGTTATTAAagttttt
page-top