Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16169  (registered. 2007)
Contig Information
Length 799 bp
Clones 64 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 7
Wh_r Root 7
Wh_yd Spikelet at late flowering 16
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216896 [Zea mays] >gi|194696926|gb|ACF82547.1| unknown [Zea mays]
Score 517
Evalue 5.1022e-55
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16169
ttttttttttAGACGCAAAAGTAAAAATCCATAGCAAAGAAAGGGTTATAATAGATGGCAACCACTTGATTCAAAAGAGGGGAAAGGGTCATTTTCTAAA
CATGCAA*CACAA*TAT*CTCTCAAAATCTATAAATCCACAAG*ATCTGACTTAACAT*CATAAACGGA*GTAGTACA*G*AACAAGTTGCAAG*ACGCA
GGATATCGATAGC*TTGGTATTGTTCCATCCTTGAACGAGCATGGAATTACAGCCTCCTTCCTCTTCTACCACCCTTCCGGCGGGTGCTGTCAGTGGGGA
CCGGGGTAACATCCTCAATGCGTCCAATCTTCATGCCAGAACGTGCAAGAGCTCTAAGCGCAGCTTGAGCACCAGGACCTGGAGTTTTTGTCTTGTTTCC
ACCAGTAGCACGGAGCTTAATGTGCAGAGCAGTAATTCCAAGCTCCTTACATCTTACAGCAACAT*CCTGAGATGCAAGCATAGCTGCATAAGGGGATGA
TTCATCACGATCAGCTTTGACCTTCATGCCACCGGTGATGCGGAC*GAGCGTCTCCCTCCCGGACAG*AT*CCGTGACATGGATGAAGG*TGTCGTTGAA
GGAGGCGAA*GATGTGCGCGACGCCGAA*GACGTGCTCCCCCTCGCGGACGGCGGGGCCCGAGCG*TCACGTTCTCCT*CCTTGGGCTCGCGGGTCTTCT
TCCT*CCCTGACATGGCGGCGGCGGCGGCGGCGAGAGGAGGAGGAGGCATATGAATAATGCTAGATGTACGTGTCag*ctTGTGCCGTGGTATGCAAtc
page-top