Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16168  (registered. 2007)
Contig Information
Length 843 bp
Clones 64 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_dL Crown of seedling 8
Wh_yd Spikelet at late flowering 20
Wh_yf Spikelet at early flowering 29
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 138
Evalue 1.71681e-15
Total Hit Count 9
Registered year 2007
Contig Sequence     [ Download ]
>Contig16168
ggcGCGTagnaAATAAGATCGGTACTTATATGTCGGACCAACAAATCACGACACGCAAACATTTGCATTTGAG*CTAAGCTCATACTACATC*CATGCAA
ACACAG*C*TAGTTAAACTGCAAATCCGACACTAGTACACACGACTGACGACGGTACAA*T*CTACTGGCACCTCGTTGGAACACACAACAG*ATTAACC
TGAAACAGCTGCAACATTATT*CAACACTACTAAGCAGGTGCGGCAGCTAGCTAGACGGGCGATGGATGGATCGATCTATGGGTTGTAGTAGACGATCTT
GATCTCGGTGACGCCGTGGCAGTTGCCGCCGGGGACGGAGTGCTCGAAGCAGTGGTTGCCGCTGTTGCATCCGGCGGTGGGGCAGTGCCCCTGCAGCGGG
CCTCCCGTGCGGGGTGACGGAGACGCGGATGGGCATGTTGGCCTGGTCGGTGCTCACCTCGTAGTACGCCCCGCCCGTCGTGGCCC*AGGTGGAACTTGG
CCACGGCGGCGCCCTGCGCCGACACGCTCCCGGACCACGAGCACACGTCGAACGACTC*GTGCTT*CCCGTTGGGGAGCAGCCAGCCGTTGGGGAAGAGG
ACCTTGCTGTCCGCCACCGCCGCGATACCCAGGTTCA*GGTCGTGGCCGCACAGGTTCTGCACCGTCACCTTGTGGCCGCCGCAGCCTTGACCGGCGGCA
GACAT*GGCCGTTGCGGACAGAGCCACGAGCAGCAGGAGGGCGAGGGGCTTCGAGGCCGCCATTGTTAGCTAGCTAGCTGTGTGGTGCTATGACCAGGGA
GTCGAGGAAGAAGAGAGGCtgcctcgtgccgaattncctgcag
page-top