Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9501  (registered. 2012)
Contig Information
Length 1140 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|215678960|dbj|BAG96390.1|| unnamed protein product [Oryza sativa Japonica Group]
Score 257
Evalue 2.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9501
GGGGAGGAGGTGGAGGAGGAAGCGCCGAGCGAANNNNNNAATCGAGTGAGCGGGCCGGCGGCGCGGCGCGGCGGCTGCCTTCTCTGCGCGTCCGGTCGAG
CTCGGTTCGTCGGGTGAGCGCGGTCGATTCAAGAGCTTAAGGGAGCATGAGTACTGCCAACGGCACACGGCGTGCCTCCAGAAGGCAATCACAAGATGCT
GATAAGGTCGTCGTGAACTTGGTCTCAACCCCCCCAGCGGCGGGCAGCCGACGTGGAGTATCGACCTCTAACGCTGGCGCGCGCACCTCACCCATTGATG
TGGAAGCCCTCGAGGATGAAGTGCAGGTCGTATCAGCTTCACAAGTGCCTCCTCAGAGGAGGAACCGGAGACCCAGGAGGCAGCCTGTGACAGTAGTTGA
TCTCGATGTACATGCTATCCGGCAAGGAGTGTCTCATGATGATAATGCAACAGTGCTTTCTCATAACACAAGGAACAAACGCCCAAGAGTTTCCCCTGTA
ATAAACATCTCTCCAGAAACAGGAGAAGGGTCCAGCTTACAGTCAAAAAATGCGGGGAAAACTAGCAAAGAGCCTGTGAAGGTGGCTCCAAAGGAACCCA
TCTTCACCTGCCCGGTGTGTTGGAACAAGTTGGACGAGCCCGCCACAACAATGTGCGGCCACATCTTCTGTACAAACTGCATCAAGCAAGCCATCCAGTA
CCAGAAGAAATGTCCTACCTGCCGGAAGCACCTGAAGATGAACAATTTCCATCGCATTTACCTTCCTAACACCTCCCGTTAAGGGTCAGGAGTCCTCCCA
GGGAGAACCATGGTGGATCTTCTGCTTGGGAGCATTGTGTATCATCATCACCTAGATGAATGTATGGAAATGGGTCGGTAGGAGTTCATCGTCCTGATGA
CCGGACTGGATAACCTTCTGCCTGAAATGGGTTAACCTGATAAAGATAGTGGATAGCCTTCTGCCTGAAATGGGTTTAACCTGATAAACAGAGTGGATAG
CCTTCTTCTGCCTGAAATGGGTTTTACAAATTTGCCTGTAGCCTTCTGTATATTGTTTGCGGCAACTTAAAAATGTTGTATGTATTAGGCTAATAGCCTT
GTACCCTTCTCTTCTCCATAGTTGGTCGATGTAACTGCAT
page-top