Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16151  (registered. 2007)
Contig Information
Length 1043 bp
Clones 60 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 14
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 13
Wh_oh Pistil at heading date 8
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative 40S ribosomal protein S3 [Triticum aestivum]
Score 1121
Evalue 1.54887e-120
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16151
ggctgaggaatTCGGCACGAGG*CTCTTCTCTCCTCTGCCCACAAAACCCTAGCCGTCGTCTCACAGCTCGCCGCCGACGCAGCGAGCTCTTCCTCCACC
GCCGCAACCATGGCGACCCAGATCAGCAAGAAGAAGAAGTTTGTGAGCGATGGCGTTTTCTACGCCGAGCTGAACGAGATGCTGACCCGGGAGCTTGCCG
AGGACGGCTACTCCGGCGTGGAGGTGCGCGTGACGCCGA*TGCGCACGGAGA*TCATCATCAGGGCCACGCGGA*CGCAGAA*CGTGCTTGGTGAGAAGG
GCCGCAGGATCAGGGAGCTCACCTCCG*TCGTCCAGAAGCGCTTCAACTTCCC*GGAGAACGGCGTTGAGCTTTACGCCGA*GAAGGTCGTCAACCGTGG
CCTCTGCGCCATCGCCCAGGCTGAGTCACTCCGCTACAAGCTCCTCGGAGGCCTTGCCGTCCGCAGGGCATGCTATGGTGT*TCTTCGCTTTGTTATGGA
GAGTGGTGCTAAGGGTTGTGAGGTCATTGTGAGCGGCAAGCTCAGGGCCCAGAGAGCCAAGTCGATGAAGTTCAAGGACGGGTACATGATCTCATCTGGT
CA*GCCCGTCAACGAGTACATTGATGCT*GCAGTTAGGCACGTTCTTCTCAGACAGGGCGTTCTTGGTATCAAGGTGAAGATTATGCTTGACTGGGACCC
CAAGGGCAAGCTTGGCCCTACCACCCCGCTGCCTGACCTCGTCACCATCCACCCCCCTAAGGAGGAGGACGAGCTGCGCCCCCCTGCTTTGGTTGAGGTC
TGAAGTCCCAATAGAGCAAGCAGACCATGAAACGTCACATCATTTTGGTCCTAGCTAGTTTTCTATCCC*TGTGATAAGCGAGG*GCTATGCAACGCTTG
GTTACCTATCTTACTTTTTAATGGACAAAAGTTT*CTGTGTAATGCTGCTATGTTAATTTCGTTTAAACTAAGTTTTGCCGAGACGAG*CTATGTATGCC
TGAAACCTTTGTTTGGATTGATTCTGCCCAGCtaaaaaaaaaa
page-top