Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9500  (registered. 2012)
Contig Information
Length 1601 bp
Clones alternative view 46 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|119150|sp|P17786.1|EF1A_SOLLC|EF1A_SOLLC RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha
Score 543
Evalue 2.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9500
TTTTTTTTTTACCAAACTGCAAACGGCAACACAGGTTTCGCAAGTTTGCCACAGATGATCCCCAGCAAAGTTTTAAATTTACAAAAACTATAACCAGGAG
CAGCTCAATTCAGACTAAGGTTTATCAGTTCGCTTAAATAAGGTGTCCAATACCGACGATGTACCACTCAAGACAAGGTTTCTACATAAACAGTAGCTCA
ACACCGCAGCTCCAGCTGGTATATATTTTTTATCAGGTAAAGAGGAGCCCAGCATAAAGCAATCGACACGCGAAATCGATGGATCTCTTCACTCCCCTGG
TGCAGAAACCCCTTGCTTCAGCTTTTCCCTCTTGAGCTTCTTCTTGGAGACTGGCTTCTTCTTCTTCGGAGGGAGCGTCTTCTGCGCATACAGGTACAGC
GCATAGTTCCCAACAAAGAAAAGCAGCAGGGTGGTAGCAACCACAAGCAGGACTATCATTCCAGGGTTCAGGCCCTTGTTCACCTCTTCGATGATTACAT
TGTTCGCTGACTCCGCGAACTTCTCCGCCATGGCGGCCACGAGATCTGGACCAGGCACCGCGCCCTCCTCGCCTTCTGAACCGAGAGATTGGATGGATTA
GGCCAGGGGCGAGTAGGAGATAAGCACTGGAGTTCTTCGAGGAGGATGGTTCGTAAGCCTCGTGCAGAGAGAGAACTAGTCTCGAGACTAGTTCTCCCGC
CGCGGCTTCGACTCCAGCGCCTCCTCCCTTCCCCTCATCGTCTCCGGTCAGCCAGGTAGTTAACAGCTCCAGCAGCCATGGGCAAGGAGAAGATCCACAT
CAGCATTGTGGTCATTGGCCATGTCGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATCGAGAGG
TTCGAGAAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGGGGTATCACCATTGATA
TTGCTCTGTGGAAGTTTGAGACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTGACTTCATCAAGAACATGATCACTGGGACCTCCCA
GGCTGATTGTGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTTGCTTTC
ACTCTTGGTGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCGAAGGCCCGTTATGAAGAAATTGTCAAGGAAGTCT
CTTCATACCTGAAGAAGGTCGGTTACAACCCTGACAAGGTTCCCTTCGTTCCCATCTCTGGGTTCGAGGGCGACAACATGATTGAGAGGTCCACCAACCT
TGACTGGTACAAGGGCCCCACCCTTCTTGAGGCCCTGGACCAGATCAATGAGCCCAAGANNCCCTCCGACAAGCCCCTGCGTCTTCCCCTTNNNNNCGTG
TACAAGATTGGTGGCATTGGAACTGTGCCAGTGGGGCGTGTTGAGACTNNAGTCATCAAGCCAGGCATGGTTGTCACCTTTGGTCCTACTGGCCTGACCA
C
page-top