Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16125  (registered. 2007)
Contig Information
Length 1775 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_dL Crown of seedling 16
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 6
Wh_r Root 9
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Enolase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1782
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig16125
gcaggaatTCGGCACGaggTCTCCCCTCTCCTCGCCTTCTCCGCCCTCCGCTCCATTCGTTTCGATCTATTTCGGCTTCCTCTCC***A**AGCTTCGGC
CATGGCGGCGACGATCCAGTCCGTGAAGGCCCGCCAG*ATCTTCGACAGCCGCGGTAACCCCACCGTCGAGGTTGATGTGTGCT*GCTCAGATGGAACCT
TTGCCAGGGCCGCTGTTCCCAGCGGTGCATCAACTGGTGTTTATGAAGCTTTGGAACTGAGGGACGGTGGATCTGACTACTTGGGAAAGGGTGTATCCAA
GGCTGTTGACAATGTGAACTCGATTATCGCGCCAGCTTTGATTGGCAAGGACCCTACCGCTCAAACTGAGcctCGACAACTTTATGGTTCAGCAGCTTGA
TGGAACCAAGAATGAGTGGGGTTGGTGCAAGCAAAAGCTTGGTGCTAATGCAATCCTGGCTGTGTCACTAGCTGTTTGCAAAGCTGGAGCCAGCGTCAAG
AAGATTCCGCTGTACCAGCACATTGCCAACCTTGCTGGCAACAAGCAATTGGTTTTGCCTGTTCCTGCATTCAATGTCATCAAT*GGTGGATCCCATGCT
GGAAACAAGCTTGCTATGCAGGAGTTCATGATCCTTCCTACTGGAGCTGCCTCATTCAAGGAGGCAATGAAGATGGGCGTTGAAGTGTACCACAACTTGA
AGTCTGTTATCAAGAAGAAGTATGGGcaAGATGCCACCAATGTTGGAGATGAAGGTGGTTTTGCTCCTAACATTCAGGAGAACAAGGAGGGCCTTGAGCT
CTTGAAGACTGCAATTGAAAAGGctggatacaccggcaaggttgtcattggaatggatgttgctgcttcagagttctacaatgacaaggacaaaacctat
gacctcaacttcaaggaagagaacaacgatgGTTCCCAGAAGATATCTGGAGATAGCCTGAAGAATGTATACAAGTCATTCGTGAGTGAGTACCCC*ATT
GTGTCGATTGAGGACCCATTTGACCAGGATGACTGGGTGCACTATGCTAAGATGACTGAGGAATGTGGAGTGGAAGTTCAGATTGTTGGTGATGACCTTC
TAGTCA*CCAACCCAACCAGA*G*TTGCTAAGGCAATCAAGGAGAAGTCATGCAATGCTCTTCTGCTGAAGGTTAACCAAATTGGATCCGTCACTGAGAG
TATTGAGGCCGTGAAGATGTCAAAACATGCTGGTTGGGGTGTGATGACCAGTCACAGGAG*TGGTGAGACTGAGGACACATTCATTGCTGATTTGGCTGT
CGGTTTGTCCACGGGCCAGATCAAGACTGGGGCTCCCTGCCGCTCAGAGCGGCTTGCCAAGTACAACCAGCTTCTGAGGATCGAGGAGGAGCTGGGCGCT
GCCGCTGTGTATGCCGGCCTCAAGTTCCGTGCACCGGTGGAGCCATACTAGATGGGATCTGCATCCGAGACATGATCACCACTCTGCACTTGTTTTTGTG
AAAGTGGGCGTGTGTTAACTTGTGGAATGAACTATGGTTGAAGC*TCTTAGGACTTGTCGAGCAATAATGTACCGCATGTTGCTGTGAACGGGACGGATA
TGTACC*TACGTACTCCAAACTTGCTCCAATTTTGGTCTTTGTGGTGAGCGAGCAAGTACGCCTGATTACCTTTTGGATCTGTAGTAAACTGTTTGGCTG
TTGGCATCATCATATTTGGCGTCAGTTTAATCTTGCAGAAagcatgcttttcgttcgccattcctaanaaaaaaa
page-top